View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0912_high_29 (Length: 216)

Name: NF0912_high_29
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0912_high_29
NF0912_high_29
[»] chr7 (1 HSPs)
chr7 (1-79)||(42379457-42379535)


Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 42379457 - 42379535
Alignment:
1 gttgccaaatgttggtagttttcaatttggtttttattgtattaatatatgcaaaataatgtatgtagaaaagaaagaa 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
42379457 gttgccaaatgttggtagttttcaatttggtttttattgtattaatatatgcaaaagaatgtatgtagaaaagaaagaa 42379535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University