View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0912_high_9 (Length: 427)
Name: NF0912_high_9
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0912_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 4e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 30 - 204
Target Start/End: Complemental strand, 19236045 - 19235875
Alignment:
| Q |
30 |
gttatttcttatggaccattttgtgtctgtctaggactctaggtattcaaatttgatttttctgaaatcagtctgttatgagagaaaatttcttgctagc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
19236045 |
gttatttcttatggaccattttgtgtctgtctaggactctaggtattcaaatttgatttttctgaaaccagtct----tgagagaaaatttcttgctagc |
19235950 |
T |
 |
| Q |
130 |
attttggcaagcaatatgaaatattttggaatgattggattgaatgaattaaactcaaagtatgatgatcatttc |
204 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19235949 |
attttggcaagcaatatgaaagattttggaatgattggattgaatgaattaaactcaaagtatgatgatcatttc |
19235875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 283 - 417
Target Start/End: Complemental strand, 19235795 - 19235661
Alignment:
| Q |
283 |
aagtgcatgaatcccttaggctgttcatccttccattaccaaattaggatgatgctaaatgattttgatgtaatactttatgctgatggctatagagatt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19235795 |
aagtgcatgaatcccttaggctgttcatccttccattaccaaatcaggatgatgctaaatgattttgatgtaatactttatggtgatggctatagagatt |
19235696 |
T |
 |
| Q |
383 |
atttatatatccctgtaagcacttaatgacctttg |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19235695 |
atttatatatccctgtaagcacttaatgacctttg |
19235661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University