View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0912_low_21 (Length: 348)
Name: NF0912_low_21
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0912_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 8e-52; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 208 - 336
Target Start/End: Original strand, 2021613 - 2021741
Alignment:
| Q |
208 |
ttaacttcattatcaattatgtgtgttat---tccgtatttatttcggttccattaaactatggaaaattttacatggttttctaacggatgaatatcct |
304 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2021613 |
ttaacttcattatcaattatgtgtgttattattccgtatttatttcggttccattaaactatggaaaattttacatggttttctaacggatgaata---t |
2021709 |
T |
 |
| Q |
305 |
aatccaaaaaagatgaagaaaatatgaatatt |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2021710 |
aatccaaaaaagatgaagaaaatatgaatatt |
2021741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 101 - 139
Target Start/End: Original strand, 2021613 - 2021651
Alignment:
| Q |
101 |
ttaacttcattatcaattatgtgtgttattattccgtat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2021613 |
ttaacttcattatcaattatgtgtgttattattccgtat |
2021651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 172 - 209
Target Start/End: Complemental strand, 31178645 - 31178608
Alignment:
| Q |
172 |
acggtgcatcaattgttgacacatgaacaacacaagtt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31178645 |
acggtgcatcaattgttgacacatgaacatcacaagtt |
31178608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 65 - 102
Target Start/End: Complemental strand, 31178645 - 31178608
Alignment:
| Q |
65 |
acggtgcatcaattgttgacacatgaacaacacaagtt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31178645 |
acggtgcatcaattgttgacacatgaacatcacaagtt |
31178608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 2021620 - 2021651
Alignment:
| Q |
1 |
cattatcaattatgtgtgttattattccgtat |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2021620 |
cattatcaattatgtgtgttattattccgtat |
2021651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University