View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0912_low_29 (Length: 318)
Name: NF0912_low_29
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0912_low_29 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 97 - 318
Target Start/End: Complemental strand, 28347440 - 28347218
Alignment:
| Q |
97 |
aacatgcaccttcttatctcaatggttatgtttgtcctacatgacaaaacattcatactacttcatcccatcataaatattctattcannnnnnn-gtca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28347440 |
aacatgcaccttcttatctcaatggttatgtttgtcctacatcacaaaacattcatactacttcatcccatcataaatattctattcatattttttgtca |
28347341 |
T |
 |
| Q |
196 |
tatgatgataatttatctaatgctcaccctcgttttgttgtctcttcatgatcatcctgaactcaaatcttttacttaggcaaacatgatcacgatgatc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28347340 |
tatgatgataatttatctaatgctcaccctcgttttgttgtctcttcattatcatcctgaactcaaatcttttacttaggcaaacatgatcacaatgatc |
28347241 |
T |
 |
| Q |
296 |
cttattcaaatattccagcttat |
318 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28347240 |
cttattcaaatattccagcttat |
28347218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University