View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0912_low_36 (Length: 296)
Name: NF0912_low_36
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0912_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 3085174 - 3084894
Alignment:
| Q |
1 |
gttgaaattggacctattactttctccagaatgaatccaccccttaaagcttcttggtctaggctttctatcctccctattgcttttgctatgccttgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3085174 |
gttgaaattggacctattactttctccagaatgaatccaccccttaaagcttcttggtctaggctttctatcctccctattgcttttgctatggcttgta |
3085075 |
T |
|
| Q |
101 |
gagtcatttgctttggtggcaactttgagaattgaccaatctgcatttgtaatatttgtgagtaaattaaaaataattttgtttcatcaaacattatact |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3085074 |
gaatcatttgctttggtggcaactttgagaattgaccaatctgcatttgtaatatttgtgagtaaattaaaaataattttgtttcatcaaacattatact |
3084975 |
T |
|
| Q |
201 |
tataaaaataggaatgtagattctggtatatggtaggatcttgtattcatgtattcgtgacattggtagttgtatgatgat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3084974 |
tataaaaataggaatgtagattctggtatatgatacgatcttgtattcatgtattcgtgacgttggtagttgtatgatgat |
3084894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 28 - 176
Target Start/End: Complemental strand, 3093993 - 3093845
Alignment:
| Q |
28 |
agaatgaatccaccccttaaagcttcttggtctaggctttctatcctccctattgcttttgctatgccttgtagagtcatttgctttggtggcaactttg |
127 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||| || |||||| ||||||||||||||||| ||| | | ||| ||||||||||||||||||||| |
|
|
| T |
3093993 |
agaatgaatccacccctgaatgcttcttggtccaggctctccatcctctctattgcttttgctatggcttctggggtcctttgctttggtggcaactttg |
3093894 |
T |
|
| Q |
128 |
agaattgaccaatctgcatttgtaatatttgtgagtaaattaaaaataa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3093893 |
agaattgaccaatctgcatttgtaatatttgtgagcaaattaaaaataa |
3093845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University