View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0912_low_39 (Length: 288)
Name: NF0912_low_39
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0912_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 39170367 - 39170153
Alignment:
| Q |
1 |
gtaatagaaagtgggagagtaaaaaacttgatgactagtttaagatgtgattgtcttagctaagtattgtattttctattttttaagatgagtcatataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39170367 |
gtaatagaaagtgggagagtaaaaaacttgatgactagtttaagatgtgattgtcttagctaagtatcgtattttctattttttaagatgagtcatataa |
39170268 |
T |
|
| Q |
101 |
ttttggaataaggaaatttaagtgagttggactctaaaaaggtcaccagaattatgaaaggtttggtaagcactacctattagaatgaacaatcacatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39170267 |
ttttggaataaggaaatttaagtgagttgaactctaaaaaggtcaccaaaattatgaaaggtttggtaagcactacctattagaatgaacaatcacatat |
39170168 |
T |
|
| Q |
201 |
gcttgtctctgctcc |
215 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
39170167 |
gcttgtttctgctcc |
39170153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University