View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0912_low_54 (Length: 248)
Name: NF0912_low_54
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0912_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 39075469 - 39075248
Alignment:
Q |
1 |
ctccaacgacgtgttagacaaaacatgaaaataatttatggttgggtgtaactcaaccttataaaacgggcatgtgaggtaaagattacctcaacttata |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
T |
39075469 |
ctccaacgacgtgttagacaaaacatgaaaataatttatggttgggtgtaaatcaaccttataaaactggcatgtgaggtaaaaattacctcaacttata |
39075370 |
T |
 |
Q |
101 |
aacatttattcataccaaatcacttccaatataggattcttaacacaccccctcacacgcatgattggacatcagaaacatggttcacactataaaatag |
200 |
Q |
|
|
||||||||||||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
39075369 |
aacatttattcataccaaatcacttccaatacaggactcttaatacaccccctcacacgcatgattggacatcggaaaaatggttcacactataaaatag |
39075270 |
T |
 |
Q |
201 |
tcagccatatgaagggacaaat |
222 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
39075269 |
tcagccatatgaagggacaaat |
39075248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University