View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0912_low_61 (Length: 216)
Name: NF0912_low_61
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0912_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 42379457 - 42379535
Alignment:
Q |
1 |
gttgccaaatgttggtagttttcaatttggtttttattgtattaatatatgcaaaataatgtatgtagaaaagaaagaa |
79 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
42379457 |
gttgccaaatgttggtagttttcaatttggtttttattgtattaatatatgcaaaagaatgtatgtagaaaagaaagaa |
42379535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University