View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0912_low_62 (Length: 214)
Name: NF0912_low_62
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0912_low_62 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 72 - 214
Target Start/End: Complemental strand, 44079744 - 44079602
Alignment:
| Q |
72 |
gagatgaatgcattgaagtcagcatttgcgtatgatgtggtaaatgacatgtggatcccgcttcctgatatggcgagggagcgcgatgagtgtaaggttg |
171 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44079744 |
gagaagaatgcattgaagtcagcatttgcgtatgatgtggtagatgacatgtggatcccgcttcctgatatggcgagggagcgcgatgagtgtaaggttg |
44079645 |
T |
 |
| Q |
172 |
tgttttgtgccaaagacaatggctctggcacaatcaaagttgt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44079644 |
tgttttgtgccaaagacaatggctctggcacaatcaaagttgt |
44079602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 84 - 214
Target Start/End: Complemental strand, 44074792 - 44074662
Alignment:
| Q |
84 |
ttgaagtcagcatttgcgtatgatgtggtaaatgacatgtggatcccgcttcctgatatggcgagggagcgcgatgagtgtaaggttgtgttttgtgcca |
183 |
Q |
| |
|
||||| ||||| ||||||||||| |||| |||||| ||||| || ||||||||||||||| ||||||||| ||||||||||| | |||||||||||| |
|
|
| T |
44074792 |
ttgaaatcagcgtttgcgtatgacgtggcaaatgatgtgtgggtctcgcttcctgatatggtgagggagcgtgatgagtgtaaagctgtgttttgtgctg |
44074693 |
T |
 |
| Q |
184 |
aagacaatggctctggcacaatcaaagttgt |
214 |
Q |
| |
|
| ||||||||| |||||| ||||||||||| |
|
|
| T |
44074692 |
gaaacaatggctttggcacgatcaaagttgt |
44074662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University