View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0912_low_65 (Length: 206)
Name: NF0912_low_65
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0912_low_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 14529680 - 14529800
Alignment:
| Q |
1 |
tttgctaacctggacccgagtaccttatgatttatcatatgcctcatatctagttgataaagaaaaacacgaatggtcttgtatttatttagtcggggaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14529680 |
tttgctaacctggaccagagtaccttatgatttatcatatgcctcatatctagttgataaagaaaaacacgaatggtcttgtatttatttagtcagggaa |
14529779 |
T |
|
| Q |
101 |
tgtttactcatggtgttattt |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
14529780 |
tgtttactcatggtgttattt |
14529800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 14534947 - 14535045
Alignment:
| Q |
21 |
taccttatgatttatc--atatgcctcatatctagttgataaagaaaaacacgaatggtcttgtatttatttagtcggggaatgtttactcatggtgtt |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||| | ||||||||||||||||||||| ||| || |||||||||| ||||||| |
|
|
| T |
14534947 |
taccttatgatttatcctatatgcctcatatctagtagataaagaaaatctcgaatggtcttgtatttatttggtcaggaaatgtttacttgtggtgtt |
14535045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 90
Target Start/End: Original strand, 14548059 - 14548128
Alignment:
| Q |
21 |
taccttatgatttatcatatgcctcatatctagttgataaagaaaaacacgaatggtcttgtatttattt |
90 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| |||| |||||| | | |||| ||||| |||||||| |
|
|
| T |
14548059 |
taccttatgatttatcttatgccttgtatctagtagatatagaaaagctcaaatgatcttgcatttattt |
14548128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 118
Target Start/End: Original strand, 14553331 - 14553379
Alignment:
| Q |
70 |
cgaatggtcttgtatttatttagtcggggaatgtttactcatggtgtta |
118 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| || |||||||| |
|
|
| T |
14553331 |
cgaatggtcttgtatttatttggtcagggaatgttttcttgtggtgtta |
14553379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University