View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0912_low_68 (Length: 202)
Name: NF0912_low_68
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0912_low_68 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 34966003 - 34965881
Alignment:
| Q |
1 |
cttatggaagaatcacatctaaccaaggttaccactttatggtttagaaattattcttcgcagcactcaaacatggatgctttgtactgtttgtagtact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34966003 |
cttatggaagaatcacatctaaccaaggttaccactttatggtttagaaattattcttcgcagcactcaaacatggatgctttgtactgtttgtagtact |
34965904 |
T |
|
| Q |
101 |
tgctacagttattttcttttctc |
123 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
34965903 |
tgctacagtttttttcttttctc |
34965881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 18424002 - 18423915
Alignment:
| Q |
1 |
cttatggaagaatcacatctaaccaaggttaccactttatggtttagaaattattcttcgcagcactcaaacatggatgctttgtact |
88 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| | |||| | |||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18424002 |
cttatggaagaaagacatctaaccaaggttaccaatgtatgatatagatattattcttctaagcactcaaacatggatgctttgtact |
18423915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University