View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0912_low_69 (Length: 202)

Name: NF0912_low_69
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0912_low_69
NF0912_low_69
[»] chr1 (2 HSPs)
chr1 (1-116)||(222602-222717)
chr1 (1-116)||(242675-242790)
[»] chr2 (1 HSPs)
chr2 (1-116)||(12030403-12030518)
[»] chr3 (1 HSPs)
chr3 (1-109)||(51529337-51529445)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 222717 - 222602
Alignment:
Q  1 ccctacatgatcggttttgggatattgcagattttcttgtctcaaattcccaactttcacaaactgacatggatatcaaccattgccgcaatcacctcat 100  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |    
T  222717 ccctatatgatcggttttgggatattgcagattttcttgtctcaaattcccaactttcacaaactgacatggatatcaaccattgccgctatcacctcgt 222618  T
Q  101 ttggttatgtattcat 116  Q
    ||||||||||||||||    
T  222617 ttggttatgtattcat 222602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 242675 - 242790
Alignment:
Q  1 ccctacatgatcggttttgggatattgcagattttcttgtctcaaattcccaactttcacaaactgacatggatatcaaccattgccgcaatcacctcat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |    
T  242675 ccctacatgatcggttttgggatattgcagattttcttgtctcaaattcccaactttcacaaactgacatggatctcaaccattgccgctatcacctcgt 242774  T
Q  101 ttggttatgtattcat 116  Q
    ||||||||||||||||    
T  242775 ttggttatgtattcat 242790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 12030518 - 12030403
Alignment:
Q  1 ccctacatgatcggttttgggatattgcagattttcttgtctcaaattcccaactttcacaaactgacatggatatcaaccattgccgcaatcacctcat 100  Q
    |||||||||||  ||||||||| ||||||||||||||||||||||||||| ||||||||  || |||||||||| |||||| |||| ||||| ||||| |    
T  12030518 ccctacatgattagttttgggacattgcagattttcttgtctcaaattccaaactttcatgaattgacatggatttcaaccgttgctgcaattacctcgt 12030419  T
Q  101 ttggttatgtattcat 116  Q
    ||||||||||||||||    
T  12030418 ttggttatgtattcat 12030403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 51529337 - 51529445
Alignment:
Q  1 ccctacatgatcggttttgggatattgcagattttcttgtctcaaattcccaactttcacaaactgacatggatatcaaccattgccgcaatcacctcat 100  Q
    ||||||||| ||||||||||||| || |||||||| ||||||||||| || || || || ||  | |||| |||||||||  |||| || || ||||| |    
T  51529337 ccctacatgctcggttttgggatctttcagattttattgtctcaaatcccaaatttccataagttaacattgatatcaactgttgctgctattacctctt 51529436  T
Q  101 ttggttatg 109  Q
    |||||||||    
T  51529437 ttggttatg 51529445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University