View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_high_25 (Length: 354)
Name: NF0913_high_25
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 2357680 - 2357454
Alignment:
| Q |
1 |
gctttttccaatgtatgaggatttttcaataacaaacatattgcccaagtaagggtaatagcacttgtgtcaattcctcctgcaattagtgactgtaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2357680 |
gctttttccaatgtatgaggatttttcagtaacaaacatattgcccaagtaagggtaatagcacttgtgtcaattcctcctgcaattagtgactgtaaat |
2357581 |
T |
 |
| Q |
101 |
gaagtgaaaattttataaaaatgtgtataagagtaagtttaaataaaattcaaacatgtatcaattgaagcaaagtgtttggtaagttcgtatagagttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2357580 |
gaagtgaaaattttataaaaatgtgtataagagtaagtttaaataaaattcaaacatgtatcaattgaagcaaagtgtttggtaagttcgtatagagttt |
2357481 |
T |
 |
| Q |
201 |
ttctttctgttccattggccctccact |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2357480 |
ttctttctgttccattggccctccact |
2357454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 2351348 - 2351285
Alignment:
| Q |
17 |
gaggatttttcaataacaaacatattgcccaagtaagggtaatagcacttgtgtcaattcctcc |
80 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||| |||| | |||||||||| ||||||| |
|
|
| T |
2351348 |
gaggatttttcaatagtaaacatattgcccatgtaagagtaacactacttgtgtcacttcctcc |
2351285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 2368741 - 2368684
Alignment:
| Q |
1 |
gctttttccaatgtatgaggatttttcaataacaaacatattgcccaagtaagggtaa |
58 |
Q |
| |
|
|||||||||||| | |||||||| | | |||||||||||||||||| |||||||||| |
|
|
| T |
2368741 |
gctttttccaatattagaggatttctaagtaacaaacatattgcccatgtaagggtaa |
2368684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 17 - 105
Target Start/End: Complemental strand, 4305677 - 4305589
Alignment:
| Q |
17 |
gaggatttttcaataacaaacatattgcccaagtaagggtaatagcacttgtgtcaattcctcctgcaattagtgactgtaaatgaagt |
105 |
Q |
| |
|
||||||||| || ||||||||| |||||||| ||||||| | | | ||||||||| |||||||||||| |||| || |||| ||||| |
|
|
| T |
4305677 |
gaggattttccagtaacaaacacattgcccatataagggtgacactagttgtgtcaactcctcctgcaatcagtgtctttaaacgaagt |
4305589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University