View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_high_28 (Length: 331)
Name: NF0913_high_28
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0913_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 29 - 265
Target Start/End: Complemental strand, 5219014 - 5218778
Alignment:
Q |
29 |
aaaaacaacttgggacggtccctacacaccaagttcaccacccaataccccctgtccttgcatctactaatagacacatgagtcccatcacacccctttt |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5219014 |
aaaaacaacttgggacggtccctacacaccaagttcaccacccaataccccctgtccttgcatctactaatagacacatgagtcccatcacacccctttt |
5218915 |
T |
 |
Q |
129 |
tgtgatcgccgctactgtctccgtgacaggcacgacagccctcgtagtccctgtcggcatacattaactggtgaagccgtcgttcggtgtgtgtgcgccc |
228 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5218914 |
tgtgatcgccgctactgtctccgtgacaggcgcgacagccctcgtagtccctgtcggcatacattaactggtgaagccgtcgttcggtgtgtgtgcgccc |
5218815 |
T |
 |
Q |
229 |
ggcagcaaagtttctcaacctcacattgttcctctct |
265 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
5218814 |
ggcagcaaagtttctcaacctcacattgttcctctct |
5218778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University