View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_high_38 (Length: 291)
Name: NF0913_high_38
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0913_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 30 - 278
Target Start/End: Original strand, 40866973 - 40867221
Alignment:
Q |
30 |
tcttttgtgttttgttctcattgccacctttcttttcatgcaaaccctagcagatacttcatgcaccgattgttttgttcaatctcatgcatcattttac |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40866973 |
tcttttgtgttttgttctcattgccacctttcttttcatgcaaaccctagcagatacttcatgcaccgattgttttgttcaatctcatgcatcattttac |
40867072 |
T |
 |
Q |
130 |
ccaaactctgaagaaaacggcacagatagtaagaaaactgataaaaaataacaaaaatgcaaacatgaaatgatatttgtaaacatgttctctcttatat |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
40867073 |
ccaaactctgaagaaaacggcacagatagtaagaaaactgataaaaaataacaaaaatgcaaacatgaaatgatatttgtaaacatgttctcttttatat |
40867172 |
T |
 |
Q |
230 |
ttatgctcttttgaactcatttcagctggtgcatgtggatttggttcct |
278 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
40867173 |
ttatgctcttttgaattcatttcagctggtgcatgtggatttggttcct |
40867221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University