View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_high_43 (Length: 287)
Name: NF0913_high_43
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_high_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 13 - 284
Target Start/End: Original strand, 5218495 - 5218766
Alignment:
| Q |
13 |
aatattcacagtcaaaatactcaaaacaaattgtgtcaacggagaacacagcattggagatgagtgggatggatagaccaggcctactatcagaaatatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5218495 |
aatattcacagtcaaaatactcaaaacaaattgtgtcaacggagaacacagcattggagatgagtgggatggatagaccaggcctactatcagaaatatc |
5218594 |
T |
|
| Q |
113 |
agcggtgttggtgaacatgagctgcaatgtcacctcagcaacggcgtggacccacaatggaagggtggcctgcattctttacgtagaagaggcatccaaa |
212 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5218595 |
agcagtgttggtgaacatgagctgcaatgtcacctcagcaacggcgtggacccacaatggaagggtggcctgcattctttacgtagaagaggcatccaaa |
5218694 |
T |
|
| Q |
213 |
cctggacccattagagacccaagacgattggcccaggtaaaggaacagctggagagtgttgtggtggcccat |
284 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5218695 |
cctggacccattagagatccaagacgattggcccaggtaaaggaacagctggagagtgttgtggtggcccat |
5218766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1107 times since January 2019
Visitors: 6709