View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_high_46 (Length: 284)
Name: NF0913_high_46
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0913_high_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 67 - 214
Target Start/End: Original strand, 11122622 - 11122766
Alignment:
Q |
67 |
ttatggcttctcaatatgtgactttttcaaccgagaatcggtttattaattgttcaagccattaatcagtcaatgattggcacattttgatacagcaaca |
166 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |
|
|
T |
11122622 |
ttatggcttctcaatatgtgactttttcaaccgagcatcggtttattaattgttcaagccatt----agtcaatgattggcacattttgatacagcagga |
11122717 |
T |
 |
Q |
167 |
aataaatttggggctg-aaattcaaatgcaataatccatgtatgcattt |
214 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
11122718 |
aataaatttggggctgtaaattcaaatgcaataatccatgtatgcattt |
11122766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University