View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0913_high_46 (Length: 284)

Name: NF0913_high_46
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0913_high_46
NF0913_high_46
[»] chr4 (1 HSPs)
chr4 (67-214)||(11122622-11122766)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 67 - 214
Target Start/End: Original strand, 11122622 - 11122766
Alignment:
67 ttatggcttctcaatatgtgactttttcaaccgagaatcggtttattaattgttcaagccattaatcagtcaatgattggcacattttgatacagcaaca 166  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||  |    
11122622 ttatggcttctcaatatgtgactttttcaaccgagcatcggtttattaattgttcaagccatt----agtcaatgattggcacattttgatacagcagga 11122717  T
167 aataaatttggggctg-aaattcaaatgcaataatccatgtatgcattt 214  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||    
11122718 aataaatttggggctgtaaattcaaatgcaataatccatgtatgcattt 11122766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University