View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_high_51 (Length: 270)
Name: NF0913_high_51
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_high_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 29 - 184
Target Start/End: Original strand, 43208156 - 43208314
Alignment:
| Q |
29 |
aatatattgatgatgtgataa---cagagaaatagagagaatgtaaagtgttgcgtatatgtataaaaaggtcgggtgtttaagtataacaattgtttct |
125 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43208156 |
aatatattgataatgtgataatagcagagaaatagagagaatgtaaagtgttgcatatgtgtataaaaaggtcgggtgtttaagtataacaattgtttct |
43208255 |
T |
|
| Q |
126 |
gttttagtaggtttcatattttattatccttcttacaattattattcgtcatgataagg |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43208256 |
gttttagtaggtttcatattttattatccttcttacaattattattcgtcatgataagg |
43208314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 644 times since January 2019
Visitors: 6705