View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_high_67 (Length: 223)
Name: NF0913_high_67
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0913_high_67 |
 |  |
|
[»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 26732812 - 26732587
Alignment:
Q |
1 |
tgatggtttttgattttgtaaagaaaaagataaatgtacaagcgtgggagatgaaagttttattaatctaggggtgagtatttgagtaattttctagttc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26732812 |
tgatggtttttgattttgtaaagaaaaagataaatgcaaaagcgtgggagatgaaagttttattaatctaggggtgagtatttgagtaattttctagttc |
26732713 |
T |
 |
Q |
101 |
ttggtct---ctgctccatgacttgtcttggtcaataaatctttaatatttgaaggaattccatctttactgttacatttactcaactattttttggttg |
197 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26732712 |
ttggtctttactgctccatgacttgtcttggtcaataaatctttaatatttgaaggaattccatctttactgttacatttactcaactattttttggttg |
26732613 |
T |
 |
Q |
198 |
caaactaaactacaaaagaaaatgac |
223 |
Q |
|
|
||||||||||| |||||||||||||| |
|
|
T |
26732612 |
caaactaaactgcaaaagaaaatgac |
26732587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 3 - 94
Target Start/End: Complemental strand, 26696873 - 26696782
Alignment:
Q |
3 |
atggtttttgattttgtaaagaaaaagataaatgtacaagcgtgggagatgaaagttttattaatctaggggtgagtatttgagtaattttc |
94 |
Q |
|
|
||||||||| ||| |||||||||||||||||||| |||| ||||||||||||| ||||||||||| |||||||||| | |||||||||||| |
|
|
T |
26696873 |
atggttttttattatgtaaagaaaaagataaatgcacaaatgtgggagatgaaaattttattaatccaggggtgagtttctgagtaattttc |
26696782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 112 - 161
Target Start/End: Complemental strand, 26696748 - 26696699
Alignment:
Q |
112 |
tccatgacttgtcttggtcaataaatctttaatatttgaaggaattccat |
161 |
Q |
|
|
||||||||||| ||||||||| || ||||||||||||| ||||||||||| |
|
|
T |
26696748 |
tccatgacttggcttggtcaacaagtctttaatatttgtaggaattccat |
26696699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 301 times since January 2019
Visitors: 6702