View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_13 (Length: 524)
Name: NF0913_low_13
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 9e-59; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 93 - 208
Target Start/End: Original strand, 24239634 - 24239749
Alignment:
| Q |
93 |
agaacaccgaagcaaagaggatttggttcgggtgagtttagtttggctattgttttttggagttgttgtttccatctttagtgggtcccaccagattcaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24239634 |
agaacaccgaagcaaagaggatttggttcgggtgagtttagtttggctattgttttttggagttgttgtttccatctttagtgggtcccaccagattcaa |
24239733 |
T |
|
| Q |
193 |
tctccaccgtacgatt |
208 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24239734 |
tctccaccgtacgatt |
24239749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 241 - 360
Target Start/End: Original strand, 24239787 - 24239906
Alignment:
| Q |
241 |
actcacctgtatcgtgagattgtgaccaccacggtttttatcaccggttgcgccggtaacatttcagactatacacggtggttaaccggtatcaataacc |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||| |
|
|
| T |
24239787 |
actcacctgtatcgtgagattgtgaccaccacggtttttatcaccggttgcgccggtaacatttcagactatacacggcaccgaaccagtaaaaataacc |
24239886 |
T |
|
| Q |
341 |
ggataaacacggtaacaaat |
360 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24239887 |
ggataaacacggtaacaaat |
24239906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 450 - 509
Target Start/End: Original strand, 24239996 - 24240055
Alignment:
| Q |
450 |
tgagtttgagtttcgcagtttacgatgaatgggtgttttggtttttgtttgagctttggt |
509 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24239996 |
tgagtttgagtttcgcagtttacgatgaatgggtgttttggtttttgtttgagctttggt |
24240055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 393 - 436
Target Start/End: Original strand, 24239933 - 24239976
Alignment:
| Q |
393 |
gttgtgtttgttgttgaaatcttcgttggaattgattgaagaag |
436 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24239933 |
gttgtggttgttgttgaaatcttcgttggaattgattgaagaag |
24239976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 176 times since January 2019
Visitors: 6702