View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_18 (Length: 492)
Name: NF0913_low_18
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_18 |
 |  |
|
| [»] scaffold0592 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 4 - 377
Target Start/End: Original strand, 15381760 - 15382133
Alignment:
| Q |
4 |
tatccttatactacatcacttgccccctgaaatttccgacagtctctgctttgcattcatctattcattcattcagacatagatcttcatatgaggaaca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15381760 |
tatccttatactacatcacttgccccctgaaatttccgacagtctctgctttgcattcatctattcattcattcagacatagatcttcatatgtggaaca |
15381859 |
T |
 |
| Q |
104 |
tttattttcatattttgaccacccaaacatttcaacttttacatcagagacacatcttgtcaaataaatgtttcataatgaaatggaagatgggtagcaa |
203 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
15381860 |
tttattttcatgttttgaccacccaaacatttcaacttttacatcagagatacatcttgtcaaataaatgttccataatgaattggaagaagggtagcaa |
15381959 |
T |
 |
| Q |
204 |
ccactacctatgcagctgaacatgcctttattacatttcaagattatattaaaatttgcatatttgaagcagaagagcataannnnnnnnnaaaaagcaa |
303 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
15381960 |
ctactacctatgcagctgaacatgcctttattacatttcaagattatattaaaatttgcatatttgaagcagaagagtataatttttttttaaaaagcaa |
15382059 |
T |
 |
| Q |
304 |
cagatcttaaaaaaggtactttagtacagaatttattctctacaaaagcttaattaaaggttagacttatagag |
377 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15382060 |
cagatcttaaaaaaggtactttggtacagaatttattctctacaaaagcttaattaaaggttagacttatagag |
15382133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0592 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0592
Description:
Target: scaffold0592; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 425 - 482
Target Start/End: Complemental strand, 2614 - 2557
Alignment:
| Q |
425 |
cctccctagctctggtagggtttcctaacatctaagtggcggccggtcccaatctctg |
482 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2614 |
cctcccgagctcttttagggtttcctaacatctaattggcggccggtcccaatctctg |
2557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University