View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_25 (Length: 415)
Name: NF0913_low_25
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0913_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 30 - 346
Target Start/End: Original strand, 17027022 - 17027335
Alignment:
Q |
30 |
atgtagtcccttggtgttcatctcgactcacttttcaagcgccttaatatgggtcatcgtattcttaaacccatgaggaacaacaaccacaaagtcttgt |
129 |
Q |
|
|
||||||||| |||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
17027022 |
atgtagtccattggtgttcatctcgagtcccttttcaagcgccttaatatgggtcattgtattcttaaacccatgaggaaca---accacaaagtcttgt |
17027118 |
T |
 |
Q |
130 |
tgacccttttggctcttcgcggacaattccttcaagttcagccgaacaagctcttcatgctcgttttatccctgaggatcagtatactcgatggccaact |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |||||| ||| ||||||||| ||| ||||| ||| |
|
|
T |
17027119 |
tgacccttttggctcttcgcggacaattccttcctgttcagccgaacaagctcttcatgcttgttctatccccgagaatcagtatattcggtggccgact |
17027218 |
T |
 |
Q |
230 |
tcaatgacgaggataattcctctttcttgtgccgcaatttttcgctgatttgcaagcatcttgaaatccttcaacttgcttccccaaggcctcgatatcc |
329 |
Q |
|
|
|||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
17027219 |
tcaacgacgaggataattcctctttcttgtgccacaattttccgctgatttgcaagcatcttgaaatccttcagcttgcttccccaaggcctcgatatcc |
17027318 |
T |
 |
Q |
330 |
ttgtccttggcctcgat |
346 |
Q |
|
|
|| |||||||||||||| |
|
|
T |
17027319 |
ttttccttggcctcgat |
17027335 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 338 - 409
Target Start/End: Original strand, 17027306 - 17027377
Alignment:
Q |
338 |
ggcctcgatatccttttccttggcctcgatgagtgtgggaatcattgtccttggtcattgtggggatccttc |
409 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
17027306 |
ggcctcgatatccttttccttggcctcgatgagtgtggggatcattgtccttggtcattgtggggatccttc |
17027377 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University