View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_29 (Length: 391)
Name: NF0913_low_29
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 81 - 328
Target Start/End: Original strand, 8143206 - 8143450
Alignment:
| Q |
81 |
ggcacaacttttcacttcaaagtgtgcaccatacgcgcttctcttgcgtggggctcataacacaaaagcctttttccttgcttttcctcactctttgtag |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8143206 |
ggcacaacttttcacttcaaagtgtgcaccatacgtgcttctcttgcgtggggctcatatcacaaaagcctttttccttgcttttcctcactctttgtag |
8143305 |
T |
 |
| Q |
181 |
annnnnnnnnnnngtctttgatatgtgcttgaggcttgaggcagaatttccacaagttgtttggattccagtatcttcatttgtgtttagtcttcatg-t |
279 |
Q |
| |
|
| |||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
8143306 |
atttttttt----gtctttgatatgtgcttgtggcttgaggccgaatttccacaagttgtttggactccagtatcttcatttgtgtttagtcttcatgct |
8143401 |
T |
 |
| Q |
280 |
tctccaacttctataaggtgtcttctgattgatcaacacaatgacctat |
328 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8143402 |
tctctaacttctataaggtgtcttctgattgatcaacccaatgacctat |
8143450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University