View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_33 (Length: 358)
Name: NF0913_low_33
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0913_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 30 - 281
Target Start/End: Original strand, 40866973 - 40867224
Alignment:
Q |
30 |
tcttttgtgttttgttctcattgccacctttcttttcatgcaaaccctagcagatacttcatgcaccgattgttttgttcaatctcatgcatcattttac |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40866973 |
tcttttgtgttttgttctcattgccacctttcttttcatgcaaaccctagcagatacttcatgcaccgattgttttgttcaatctcatgcatcattttac |
40867072 |
T |
 |
Q |
130 |
ccaaactctgaagaaaacggcacagatagtaagaaaactgataaaaaataacaaaaatgcaaacatgaaatgatatttgtaaacatgttctctcttatat |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
40867073 |
ccaaactctgaagaaaacggcacagatagtaagaaaactgataaaaaataacaaaaatgcaaacatgaaatgatatttgtaaacatgttctcttttatat |
40867172 |
T |
 |
Q |
230 |
ttatgctcttttgaactcatttcagctggtgcatgtggatttggttcctttg |
281 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
40867173 |
ttatgctcttttgaattcatttcagctggtgcatgtggatttggttcctttg |
40867224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University