View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_34 (Length: 357)
Name: NF0913_low_34
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_34 |
 |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold1990 (1 HSPs) |
 |  |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0191 (1 HSPs) |
 |  |  |
|
| [»] scaffold0112 (1 HSPs) |
 |  |  |
|
| [»] scaffold0062 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0178 (2 HSPs) |
 |  |  |
|
| [»] scaffold1086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 51)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 332
Target Start/End: Complemental strand, 32711455 - 32711119
Alignment:
| Q |
1 |
taaagagaaatcattagaaatgaaagaaagaaaacaacaattttaccaaattaattttattcatcaatgtctgatttttattattataaacgtaaagtga |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32711455 |
taaagagaaa-cattagaaatgaaagaaagaaaacaacaattttaccaaattaattttattcatcaatgtctgatttttattattataaacgtaaagtga |
32711357 |
T |
 |
| Q |
101 |
aaattattaatttataagtgatgcacgtaatattagttagagcatgtccttcaaaaattagttagagtataattgaaggaagaaacaattaaaattac-c |
199 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32711356 |
aaattattaatttataagcgatgcacataata--agttagagcatgtccttcaaaaattagttagagtataattgaaggaagaaacaattaaaattacat |
32711259 |
T |
 |
| Q |
200 |
ttttttaaaaattaaaaagtaaccgcttagctaaattggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac-------attga |
292 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
32711258 |
ttttttaaatattaaaaagtaactacttggctaaattggtagaacaatgcattattatatgcagggccggggttcgaaccccagacaccccacttattca |
32711159 |
T |
 |
| Q |
293 |
tcttttaaggtaaattctagccactagactacctgaccaa |
332 |
Q |
| |
|
||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
32711158 |
ccttataaggtgaattctagccactagactatctgaccaa |
32711119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 235 - 332
Target Start/End: Original strand, 15368820 - 15368925
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||| || || |||||| ||||||||||||||| |||||| |
|
|
| T |
15368820 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcattttataaggtgaattctagccactaggctacct |
15368919 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
15368920 |
gaccaa |
15368925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 227 - 332
Target Start/End: Original strand, 21884582 - 21884695
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccacta |
318 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||| | ||| |||||| ||||||| |||||| |
|
|
| T |
21884582 |
tagctcaattggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcaccttataaggtgaattctaaccacta |
21884681 |
T |
 |
| Q |
319 |
gactacctgaccaa |
332 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
21884682 |
gactacatgaccaa |
21884695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 235 - 285
Target Start/End: Complemental strand, 17056960 - 17056909
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagac |
285 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17056960 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagac |
17056909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 23464066 - 23464013
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
23464066 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
23464013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 49251475 - 49251422
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
49251475 |
ttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacac |
49251422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 235 - 329
Target Start/End: Original strand, 37490905 - 37491007
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||| | ||||| ||| ||||| |||||| ||||||||||||||| |||||| |
|
|
| T |
37490905 |
ttggtaggacaatgcattattatatgcaggggccggggtacgaaccacggacaccccgcttattcatcttataaggtgaattctagccactaggctacct |
37491004 |
T |
 |
| Q |
327 |
gac |
329 |
Q |
| |
|
||| |
|
|
| T |
37491005 |
gac |
37491007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 226 - 286
Target Start/End: Complemental strand, 2208727 - 2208666
Alignment:
| Q |
226 |
ttagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagaca |
286 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||| || ||||| ||||||||||| |
|
|
| T |
2208727 |
ttagctcaattggtaggacaatgcattattatatgcaggggacgaggttcaaaccccagaca |
2208666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 287
Target Start/End: Original strand, 24661989 - 24662050
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||| | || |||||||||||||||| |
|
|
| T |
24661989 |
tagctcaattggtaggacaatgcattattatatgcaggggtcaggattcgaaccccagacac |
24662050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 37733770 - 37733823
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
37733770 |
ttggtaggacaatgcattattatatgcagtggacggggttcgaaccccggacac |
37733823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 4354185 - 4354141
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaac |
278 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4354185 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaac |
4354141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 234 - 329
Target Start/End: Original strand, 12866137 - 12866241
Alignment:
| Q |
234 |
attggtaggacaatgcattattatatgc--agggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactac |
324 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||| |||| |||| ||| ||||| |||||| |||||||||||||| | ||| |
|
|
| T |
12866137 |
attggtaggataatgcattattatatgcagagggccggggttcgaatcccacacaccctacttattcatcttataaggtgaattctagccactaaattac |
12866236 |
T |
 |
| Q |
325 |
ctgac |
329 |
Q |
| |
|
||||| |
|
|
| T |
12866237 |
ctgac |
12866241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 332
Target Start/End: Complemental strand, 15774392 - 15774287
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| ||||||||||||||| ||||| ||| | ||| |||||| |||||||||||||| |||||| |
|
|
| T |
15774392 |
ttggtaggacaatgcattattatatgtaggggtcggggttcgaaccccggacaccccacttattcaccttataaggtgaattctagccactaagctacct |
15774293 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
15774292 |
gaccaa |
15774287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 17350082 - 17350129
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
17350082 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
17350129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 332
Target Start/End: Complemental strand, 43555954 - 43555849
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg-ccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||| ||||| ||| | ||| |||||| ||||||||||||||||||||| |
|
|
| T |
43555954 |
ttggtaggacaatgcattattatatgcagggatcggggttcaaacccaggacaccccacttatttaccttataaggtggattctagccactagactacct |
43555855 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
43555854 |
gaccaa |
43555849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 332
Target Start/End: Complemental strand, 46116254 - 46116149
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| |||||||||||||| ||||| ||| | ||| |||||| ||||||| ||||||| |||||| |
|
|
| T |
46116254 |
ttggtaggacaatgcattatcatatgcaggggctggggttcgaaccccggacaccccaattattcaccttataaggtgaattctaaccactaggctacct |
46116155 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
46116154 |
gaccaa |
46116149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 239 - 281
Target Start/End: Complemental strand, 17871155 - 17871114
Alignment:
| Q |
239 |
taggacaatgcattattatatgcagggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17871155 |
taggacaatgcattattatatgcaggg-cggggttcgaacccc |
17871114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 280
Target Start/End: Original strand, 20357475 - 20357521
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
20357475 |
ttggtaggacaatgcattattatatgcaggggctggggttcgaaccc |
20357521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 280
Target Start/End: Complemental strand, 20562480 - 20562434
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
20562480 |
ttggtaggacaatgcattattatatgcaggggctggggttcgaaccc |
20562434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 280
Target Start/End: Complemental strand, 23930624 - 23930578
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
23930624 |
ttggtaggacaatgcattattatatgcaggggtcggggttcgaaccc |
23930578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 243 - 281
Target Start/End: Original strand, 35111673 - 35111711
Alignment:
| Q |
243 |
acaatgcattattatatgcagggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35111673 |
acaatgcattattatatgcaggggcggggttcgaacccc |
35111711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 38020028 - 38019974
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcg-aaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||| |||||||||||| |
|
|
| T |
38020028 |
ttggtaggacaatgcattattatatgcaggggccggagttcgaaaccccagacac |
38019974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 241 - 286
Target Start/End: Complemental strand, 52833180 - 52833134
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagaca |
286 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
52833180 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggaca |
52833134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 241 - 281
Target Start/End: Complemental strand, 11907376 - 11907335
Alignment:
| Q |
241 |
ggacaatgcattattatatgcag-ggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11907376 |
ggacaatgcattattatatgcagaggccggggttcgaacccc |
11907335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 19793541 - 19793594
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||| ||||| |
|
|
| T |
19793541 |
ttggtaggacaatgcattattatatgcaggggccggaattcgaaccccggacac |
19793594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 27745172 - 27745225
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
27745172 |
ttggtaggaaaatgcattattatatgcagggatcggggttcgaaccccggacac |
27745225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 29331244 - 29331199
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg-ccggggttcgaacc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
29331244 |
ttggtaggacaatgcattattatatgcagggtccgggattcgaacc |
29331199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 287
Target Start/End: Original strand, 38021272 - 38021320
Alignment:
| Q |
240 |
aggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
38021272 |
aggacaatgcattattatatgcaggggccggagttcgaaccccggacac |
38021320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 281
Target Start/End: Complemental strand, 538409 - 538362
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
538409 |
ttggtagaacaatgcattattatatgcaggggccggagttcgaacccc |
538362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Complemental strand, 2052756 - 2052709
Alignment:
| Q |
241 |
ggacaatgcattattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||| ||||| |
|
|
| T |
2052756 |
ggacaatgcattatcatatgcaggggccggggttcgaaccccggacac |
2052709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 23345135 - 23345092
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaac |
278 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||||||| |
|
|
| T |
23345135 |
ttggtaggacaatgcattgttatatgcaggggccgggttcgaac |
23345092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 29491491 - 29491538
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
29491491 |
ggacaatgcattattatatgcaggggtcggggttcgaaccccggacac |
29491538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 39238737 - 39238784
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
39238737 |
ggacaatgcattattatatgcaggggccgaggttcgaaccccggacac |
39238784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 40678844 - 40678891
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
40678844 |
ggacaatgcattattatatgcaggggccggggttcgatccccggacac |
40678891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Complemental strand, 4429562 - 4429532
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4429562 |
ttggtaggacaatgcattattatatgcaggg |
4429532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 241 - 329
Target Start/End: Original strand, 9527447 - 9527543
Alignment:
| Q |
241 |
ggacaatgcattattatatgcagggc-cggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacctgac |
329 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| |||||| ||||| ||| ||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
9527447 |
ggacaatgcattgttatatgcaggggtcggggtttgaaccctggacaccccacttattcatcttataaggtgaattctagccactagactacctgac |
9527543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Complemental strand, 18923965 - 18923935
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18923965 |
ttggtaggacaatgcattattatatgcaggg |
18923935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 246 - 287
Target Start/End: Complemental strand, 24168648 - 24168606
Alignment:
| Q |
246 |
atgcattattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
24168648 |
atgcattattatatgtagggaccggggttcgaaccccagacac |
24168606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 233 - 286
Target Start/End: Original strand, 49916453 - 49916507
Alignment:
| Q |
233 |
aattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagaca |
286 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||| ||||||||||| ||| |||| |
|
|
| T |
49916453 |
aattggtaggacaatgcattattatatgtaggggtcggggttcgaatcccggaca |
49916507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 8261755 - 8261702
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| |||||||| || ||||||||| |
|
|
| T |
8261755 |
ttggtaggataatgcattattatatgcaggggtcggggttccaatcccagacac |
8261702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 11802100 - 11802047
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| |||||||||||||| ||||| |
|
|
| T |
11802100 |
ttggtaggacaatgcattattatatgtaggggttggggttcgaaccccggacac |
11802047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 287
Target Start/End: Original strand, 21635564 - 21635625
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcag-ggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||| | |||||||| |||||||||||| |
|
|
| T |
21635564 |
tagctcaattggtaagacaatgcattaatatatgcagatgtcggggttcaaaccccagacac |
21635625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 280
Target Start/End: Original strand, 22346427 - 22346480
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcagggccggggttcgaaccc |
280 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
22346427 |
tagctaagttggtaggacaatacattattataagcaggggtcgggttcgaaccc |
22346480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 281
Target Start/End: Original strand, 25819206 - 25819247
Alignment:
| Q |
241 |
ggacaatgcattattatatgcagg-gccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
25819206 |
ggacaatgcattattatatgtaggagccggggttcgaacccc |
25819247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 287
Target Start/End: Original strand, 30649112 - 30649161
Alignment:
| Q |
239 |
taggacaatgcattattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||| ||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
30649112 |
taggacaacgcattattatatgcaggagttggggttcgaaccccagacac |
30649161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 38851650 - 38851703
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||||||| || ||||||||| |
|
|
| T |
38851650 |
ttggtaggacaatgcattattatatgtaggtgtcggggttcaaatcccagacac |
38851703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 42831962 - 42832015
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||| |||||||||||||||| |||| ||||||| |||||| ||||| |
|
|
| T |
42831962 |
ttggtaggacattgcattattatatgcaggggctggggttcaaaccccggacac |
42832015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 265
Target Start/End: Original strand, 43237789 - 43237818
Alignment:
| Q |
236 |
tggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43237789 |
tggtaggacaatgcattattatatgcaggg |
43237818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 246 - 281
Target Start/End: Original strand, 1660969 - 1661005
Alignment:
| Q |
246 |
atgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1660969 |
atgcattattatatgcaggggccggggttcgaacccc |
1661005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 6554573 - 6554537
Alignment:
| Q |
18 |
aaatgaaagaaagaaaacaacaattttaccaaattaa |
54 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
6554573 |
aaatgaatgaaagagaacaacaattttaccaaattaa |
6554537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 24014688 - 24014644
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaac |
278 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
24014688 |
ttggtaagacaatgcattattatatgcaggggccggagttcgaac |
24014644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 9e-21; HSPs: 47)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 235 - 332
Target Start/End: Original strand, 9577317 - 9577413
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacacattgatcttttaaggtaaattctagccactagactacctgaccaa |
332 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| | ||| | ||| |||||| ||||||||||||||| |||||||||||| |
|
|
| T |
9577317 |
ttggtaggacaatgcattattatatgcatgggccggggttcgaacccca--cttattcaccttataaggtgaattctagccactaggctacctgaccaa |
9577413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 329
Target Start/End: Complemental strand, 32158505 - 32158392
Alignment:
| Q |
224 |
gcttagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagcca |
315 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||| | ||| |||||| ||||||||||| |
|
|
| T |
32158505 |
gcttagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcaccttataaggtgaattctagcca |
32158406 |
T |
 |
| Q |
316 |
ctagactacctgac |
329 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
32158405 |
ctaggctacctgac |
32158392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 33800908 - 33800961
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33800908 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacac |
33800961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 233 - 332
Target Start/End: Complemental strand, 20945973 - 20945866
Alignment:
| Q |
233 |
aattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactac |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| || ||||| ||| | ||| |||||| |||||||||||||||| ||| |
|
|
| T |
20945973 |
aattggtaggacaatgcattattatatgcaggggccggggttcgaaatccggacaccccacttattcaccttataaggtgaattctagccactagattac |
20945874 |
T |
 |
| Q |
325 |
ctgaccaa |
332 |
Q |
| |
|
|||||||| |
|
|
| T |
20945873 |
ctgaccaa |
20945866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 235 - 329
Target Start/End: Complemental strand, 29096388 - 29096286
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgc-agggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||| ||||| ||| | ||| |||||| ||||||||||||||| |||||| |
|
|
| T |
29096388 |
ttggtaggacaatgcattattatatgcaagggccggagttcgaaccccggacaccccacttattcaccttataaggtgaattctagccactaggctacct |
29096289 |
T |
 |
| Q |
327 |
gac |
329 |
Q |
| |
|
||| |
|
|
| T |
29096288 |
gac |
29096286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 227 - 329
Target Start/End: Complemental strand, 29106126 - 29106016
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccacta |
318 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||| |||||||||| |||||| ||| | ||| |||||| |||||||||||| | |
|
|
| T |
29106126 |
tagctcaattggtaggacaatgcattattatatgcaggggccgaagttcgaaccctagacaccccacttattcaccttataaggttaattctagccacca |
29106027 |
T |
 |
| Q |
319 |
gactacctgac |
329 |
Q |
| |
|
||||||||||| |
|
|
| T |
29106026 |
gactacctgac |
29106016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 235 - 332
Target Start/End: Complemental strand, 26169092 - 26168989
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-----attgatcttttaaggtaaattctagccactagactacctga |
328 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| || ||||||||||| ||||| ||| | ||| ||||||||||||||||||||| ||||| ||| |
|
|
| T |
26169092 |
ttggtaggacaatgcattattatatgcaggggttggagttcgaaccccggacacgacttattcaccttataaggtaaattctagccactaaactacttga |
26168993 |
T |
 |
| Q |
329 |
ccaa |
332 |
Q |
| |
|
|||| |
|
|
| T |
26168992 |
ccaa |
26168989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 235 - 329
Target Start/End: Original strand, 29050815 - 29050906
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacacattgatcttttaaggtaaattctagccactagactacctgac |
329 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||| || ||||| | |||||||| ||||||||||||||| ||||||||| |
|
|
| T |
29050815 |
ttggtaggacaatgcattattatatgcaggggccggggtttgaactccggacac----cccatttaaggtgaattctagccactaggctacctgac |
29050906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 2411374 - 2411321
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
2411374 |
ttggtaggacaatgtattattatatgcaggggccggagttcgaaccccagacac |
2411321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 33729793 - 33729846
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
33729793 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaatctcagacac |
33729846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 42455474 - 42455421
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
42455474 |
ttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacac |
42455421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 235 - 329
Target Start/End: Complemental strand, 19059084 - 19058982
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||| ||||| ||| | ||| |||||| ||||||||||||||| |||||| |
|
|
| T |
19059084 |
ttggtaggacaatgcattatcatatgcaggggccggggttcgaaccctggacaccccacttattcaccttataaggtgaattctagccactagcctacct |
19058985 |
T |
 |
| Q |
327 |
gac |
329 |
Q |
| |
|
||| |
|
|
| T |
19058984 |
gac |
19058982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 22600015 - 22599963
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| || ||||||||||||| |
|
|
| T |
22600015 |
ttggtaggacaatgcattattatatgcagggttgggatttgaaccccagacac |
22599963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 26302573 - 26302529
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaacc |
279 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
26302573 |
ttggtaggacaatgcattattatatacagggccggagttcgaacc |
26302529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 281
Target Start/End: Complemental strand, 973056 - 973009
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
973056 |
ttggtaggacaatgcattattatatacaggggccggggttcgaacccc |
973009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 1463892 - 1463939
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
1463892 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
1463939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 281
Target Start/End: Original strand, 18872536 - 18872583
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
18872536 |
ttggtaggacaatgcattattatatgcaggggtcggggttcgaacccc |
18872583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 281
Target Start/End: Complemental strand, 27219643 - 27219596
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
27219643 |
ttggtaggacaatgcattattatatgcatgggccggggttcaaacccc |
27219596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 281
Target Start/End: Original strand, 42595748 - 42595803
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcaggg-ccggggttcgaacccc |
281 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
42595748 |
tagctcaattggtaggacaatacattattatatgcagggaccggggtttgaacccc |
42595803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 280
Target Start/End: Original strand, 18478018 - 18478064
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgc-agggccggggttcgaaccc |
280 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18478018 |
ttggtaggacaatgcattattatatgctggggccggggttcgaaccc |
18478064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 238 - 279
Target Start/End: Complemental strand, 40339176 - 40339134
Alignment:
| Q |
238 |
gtaggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40339176 |
gtaggacaatgcattattatatgcaggggccggggttcgaacc |
40339134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 1244807 - 1244754
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
1244807 |
ttggtaggacaaagcattattatatgcaggggtcagggttcgaaccccagacac |
1244754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 29144157 - 29144210
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||| |||| |||||||| |
|
|
| T |
29144157 |
ttggtaggacaatgcattattatatgcaggggtcggggtttgaactccagacac |
29144210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 29841363 - 29841416
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgc-agggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| | |||||||||| ||||| |
|
|
| T |
29841363 |
ttggtaggacaatgcattattatatgcaagggccgagattcgaaccccggacac |
29841416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 279
Target Start/End: Complemental strand, 6614117 - 6614073
Alignment:
| Q |
236 |
tggtaggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6614117 |
tggtagaacaatgcattattatatgcaggggccggggttcgaacc |
6614073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 237 - 284
Target Start/End: Complemental strand, 7234950 - 7234902
Alignment:
| Q |
237 |
ggtaggacaatgcattattatatgcag-ggccggggttcgaaccccaga |
284 |
Q |
| |
|
|||||||||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
7234950 |
ggtaggacaatgcattattatatgtagaggtcggggttcgaaccccaga |
7234902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 244 - 287
Target Start/End: Original strand, 10943740 - 10943784
Alignment:
| Q |
244 |
caatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
10943740 |
caatgcattattatatgcaggggccggggttcgaaccccggacac |
10943784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 38426840 - 38426788
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||| |||||||||||||||| ||||| | |||| ||||||||||||| |
|
|
| T |
38426840 |
ttggtaggataatgcattattatatgtagggctgaggtttgaaccccagacac |
38426788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Complemental strand, 4674889 - 4674842
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
4674889 |
ggacaatgcattattatatgcaggggtcggggttcgaaccccggacac |
4674842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 279
Target Start/End: Complemental strand, 6447554 - 6447515
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6447554 |
ggacaatgcattattatatgcaggggccggggttcgaacc |
6447515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 237 - 287
Target Start/End: Original strand, 8015852 - 8015903
Alignment:
| Q |
237 |
ggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||| |||||||||||| ||||| ||||||||||||||||||| ||||| |
|
|
| T |
8015852 |
ggtaggataatgcattattacatgcaggggccggggttcgaaccccggacac |
8015903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 252 - 287
Target Start/End: Original strand, 9125698 - 9125733
Alignment:
| Q |
252 |
tattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9125698 |
tattatatgcagggccggggttcgaaccccggacac |
9125733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 281
Target Start/End: Complemental strand, 27440378 - 27440331
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||| || || |||||||||||| |
|
|
| T |
27440378 |
ttggtaggacaatgcattattatatgcagtggtcgaggttcgaacccc |
27440331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 273
Target Start/End: Complemental strand, 36888173 - 36888134
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggtt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36888173 |
ttggtaggacaatgcattattatatgcaggggccggggtt |
36888134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 265
Target Start/End: Original strand, 29266075 - 29266113
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
29266075 |
tagctcaattgataggacaatgcattattatatgcaggg |
29266113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 231 - 280
Target Start/End: Complemental strand, 33141873 - 33141823
Alignment:
| Q |
231 |
taaattggtaggacaatgcattattatatgcagg-gccggggttcgaaccc |
280 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | || ||||||||||| |
|
|
| T |
33141873 |
taaattgataggacaatgcattattatatgcaggagtcgaggttcgaaccc |
33141823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 843448 - 843395
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||| ||||||||||||||||||| | ||| ||||||||||||||| ||||| |
|
|
| T |
843448 |
ttggtatgacaatgcattattatatgtaggggacggggttcgaaccccggacac |
843395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 278
Target Start/End: Complemental strand, 2867685 - 2867652
Alignment:
| Q |
245 |
aatgcattattatatgcagggccggggttcgaac |
278 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
2867685 |
aatgcattattatatgcagggccggagttcgaac |
2867652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 287
Target Start/End: Complemental strand, 36045206 - 36045161
Alignment:
| Q |
243 |
acaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
36045206 |
acaatgcattattatatgcaggggtcggggttcgaaccccggacac |
36045161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 287
Target Start/End: Complemental strand, 42553209 - 42553168
Alignment:
| Q |
246 |
atgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||| ||||| |
|
|
| T |
42553209 |
atgcattgttatatgcagggtcggggttcgaaccccggacac |
42553168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 42801521 - 42801468
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||| || |||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
42801521 |
ttggtatgataatgcattattatatgcaggggtcggggttcgaaccccggacac |
42801468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Original strand, 2328627 - 2328663
Alignment:
| Q |
252 |
tattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2328627 |
tattatatgcaggagccggggttcgaaccccagacac |
2328663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 263
Target Start/End: Complemental strand, 7645182 - 7645154
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7645182 |
ttggtaggacaatgcattattatatgcag |
7645154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 286
Target Start/End: Complemental strand, 21017686 - 21017634
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaaccccagaca |
286 |
Q |
| |
|
|||||||||||||||||||||||||| || ||| |||||| ||||||| |||| |
|
|
| T |
21017686 |
ttggtaggacaatgcattattatatgtagtggctggggtttgaaccccggaca |
21017634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 263
Target Start/End: Original strand, 23648344 - 23648372
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23648344 |
ttggtaggacaatgcattattatatgcag |
23648372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 263
Target Start/End: Complemental strand, 23810228 - 23810200
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23810228 |
ttggtaggacaatgcattattatatgcag |
23810200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 263
Target Start/End: Complemental strand, 31934955 - 31934927
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31934955 |
ttggtaggacaatgcattattatatgcag |
31934927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 6e-19; HSPs: 63)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 227 - 329
Target Start/End: Complemental strand, 9285747 - 9285637
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcaggg-ccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccacta |
318 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||| | ||| |||||| |||||||||||||| |
|
|
| T |
9285747 |
tagctcaattggtaggacaatgcattattatatgcagggtctggggttcgaaccccagacaccccacttattaaccttataaggtgaattctagccacta |
9285648 |
T |
 |
| Q |
319 |
gactacctgac |
329 |
Q |
| |
|
|||||| |||| |
|
|
| T |
9285647 |
gactacttgac |
9285637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 227 - 329
Target Start/End: Original strand, 52560771 - 52560881
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccacta |
318 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||| || |||| ||| | ||| |||||| |||||||||||||| |
|
|
| T |
52560771 |
tagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccacatacacttcacttattcaccttataaggtgaattctagccacta |
52560870 |
T |
 |
| Q |
319 |
gactacctgac |
329 |
Q |
| |
|
||||||||||| |
|
|
| T |
52560871 |
gactacctgac |
52560881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 236 - 332
Target Start/End: Original strand, 10098141 - 10098245
Alignment:
| Q |
236 |
tggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacctg |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||| ||||| ||| ||||| |||| | ||||||||||||||||||||||| |
|
|
| T |
10098141 |
tggtaggacaatgcattattatatgcaggggccgggattcgaaccccggacaccccacttattcatcttataagatgaattctagccactagactacctg |
10098240 |
T |
 |
| Q |
328 |
accaa |
332 |
Q |
| |
|
||||| |
|
|
| T |
10098241 |
accaa |
10098245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 227 - 287
Target Start/End: Complemental strand, 56546537 - 56546476
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
56546537 |
tagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccacagacac |
56546476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 3442858 - 3442911
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatg-cagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
3442858 |
ttggtaggacaatgcattattatatgtcggggccggggttcgaaccccagacac |
3442911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 235 - 326
Target Start/End: Original strand, 3465598 - 3465697
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||| ||||| ||| | ||| |||||| |||||||||||||||||||||| |
|
|
| T |
3465598 |
ttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcaccttataaggtgaattctagccactagactacct |
3465697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 47018026 - 47017973
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
47018026 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
47017973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 235 - 284
Target Start/End: Original strand, 35031398 - 35031448
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagg-gccggggttcgaaccccaga |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
35031398 |
ttggtaggacaatgcattattatatgcaggagccgaggttcgaaccccaga |
35031448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 548967 - 548914
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
548967 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaaactcagacac |
548914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 6053995 - 6054048
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
6053995 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaactccaaacac |
6054048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 13211432 - 13211379
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
13211432 |
ttggtaggacaatgcattattatatgcatgggtcggggttcgaaccccggacac |
13211379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 239 - 287
Target Start/End: Complemental strand, 53698056 - 53698007
Alignment:
| Q |
239 |
taggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
53698056 |
taggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
53698007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 235 - 329
Target Start/End: Complemental strand, 20753205 - 20753103
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||||||| |||||||||||||||| | ||||||||||||||||||| ||||| ||| | ||| |||||| ||||||||||||||| |||||| |
|
|
| T |
20753205 |
ttggtaggaaaatgcattattatatgtaggggccggggttcgaaccccggacaccacacttattcaccttataaggtgaattctagccactaggctacct |
20753106 |
T |
 |
| Q |
327 |
gac |
329 |
Q |
| |
|
||| |
|
|
| T |
20753105 |
gac |
20753103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 281
Target Start/End: Complemental strand, 3544512 - 3544465
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgc-agggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
3544512 |
ttggtaggacaatgcattattatatgcaaaggccggggttcgaacccc |
3544465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 14149814 - 14149861
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
14149814 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
14149861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Complemental strand, 28520805 - 28520758
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
28520805 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
28520758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Complemental strand, 48968284 - 48968237
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
48968284 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
48968237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 265
Target Start/End: Complemental strand, 35803181 - 35803143
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35803181 |
tagctcaattggtaggacaatgcattattatatgcaggg |
35803143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 5430445 - 5430392
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || ||||||||||||| ||||| |
|
|
| T |
5430445 |
ttggtaggacaatgtattattatatgcagggaccagggttcgaaccccggacac |
5430392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 9172451 - 9172406
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
9172451 |
ttggtaggacaatgcattattatatgcaggggtcggggttcgaacc |
9172406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 9924871 - 9924924
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
9924871 |
ttggtaggacaacgcattattatatgcaggggtcggggttcgaaccccggacac |
9924924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 224 - 265
Target Start/End: Original strand, 20266866 - 20266907
Alignment:
| Q |
224 |
gcttagctaaattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
20266866 |
gcttagctcatttggtaggacaatgcattattatatgcaggg |
20266907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 24234154 - 24234101
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||| ||||||| ||||| |
|
|
| T |
24234154 |
ttggtaggtcaatgcattattatatgcaggggccggggtttgaaccccggacac |
24234101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 246 - 286
Target Start/End: Original strand, 27921922 - 27921963
Alignment:
| Q |
246 |
atgcattattatatgcaggg-ccggggttcgaaccccagaca |
286 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27921922 |
atgcattattatatgcaggggccggggttcgaaccccagaca |
27921963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 33944443 - 33944398
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33944443 |
ttggtaggataatgcattattatatgcaggggccggggttcgaacc |
33944398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 287
Target Start/End: Original strand, 8690234 - 8690282
Alignment:
| Q |
240 |
aggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
8690234 |
aggacaatgcattattatatgcaggggtcggggttcgaaccccggacac |
8690282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 35333068 - 35333024
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaac |
278 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
35333068 |
ttggtaggacaatgcattattatatgcagtggccggagttcgaac |
35333024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 243 - 287
Target Start/End: Original strand, 46799431 - 46799475
Alignment:
| Q |
243 |
acaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||| ||||| |
|
|
| T |
46799431 |
acaatgcattattatatgcagagccgaggttcgaaccccggacac |
46799475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 233 - 265
Target Start/End: Original strand, 56314774 - 56314806
Alignment:
| Q |
233 |
aattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
56314774 |
aattggtaggacaatgcattattatatgcaggg |
56314806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 245 - 287
Target Start/End: Original strand, 9692987 - 9693030
Alignment:
| Q |
245 |
aatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
9692987 |
aatgcattattatatgcaggggccggggttcgaaccccggacac |
9693030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 281
Target Start/End: Complemental strand, 35909243 - 35909196
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
35909243 |
ttggtaggacaatacattattatatgcagaggtcggggttcgaacccc |
35909196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 36954158 - 36954205
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
36954158 |
ggacaatgcattattatatgcaggggtcggggttcgaaccccggacac |
36954205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 224 - 286
Target Start/End: Complemental strand, 49089368 - 49089305
Alignment:
| Q |
224 |
gcttagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagaca |
286 |
Q |
| |
|
|||||||| | ||||||||||||| |||||||||||||| |||||| ||||||||||| |||| |
|
|
| T |
49089368 |
gcttagcttagttggtaggacaatacattattatatgcaggggccgaagttcgaacccctgaca |
49089305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 53815717 - 53815764
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
53815717 |
ggacaatgcattattatatgcaggggctggggttcgaaccccggacac |
53815764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 265
Target Start/End: Complemental strand, 534853 - 534815
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
534853 |
tagctcaattggtaggacaatgcatcattatatgcaggg |
534815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 272
Target Start/End: Complemental strand, 4722544 - 4722506
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4722544 |
ttggtaggacaatgcattattatatgcagaggccggggt |
4722506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 6365339 - 6365369
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6365339 |
ttggtaggacaatgcattattatatgcaggg |
6365369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 12868106 - 12868064
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||| || | |||||||| |
|
|
| T |
12868106 |
ttggtaggacaatgcattattatatgcagtgctgaggttcgaa |
12868064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 281
Target Start/End: Original strand, 23376199 - 23376245
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| ||||||||||||||| |
|
|
| T |
23376199 |
ttggtaggacaatgtattattatatgtaggatcggggttcgaacccc |
23376245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Complemental strand, 26708625 - 26708579
Alignment:
| Q |
241 |
ggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
26708625 |
ggacaatgcattattatatgcaggggttgggttcgaacctcagacac |
26708579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 32885703 - 32885733
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32885703 |
ttggtaggacaatgcattattatatgcaggg |
32885733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 48309160 - 48309190
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48309160 |
ttggtaggacaatgcattattatatgcaggg |
48309190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 50657895 - 50657925
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
50657895 |
ttggtaggacaatgcattattatatgcaggg |
50657925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 51077882 - 51077912
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51077882 |
ttggtaggacaatgcattattatatgcaggg |
51077912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 287
Target Start/End: Original strand, 5635208 - 5635257
Alignment:
| Q |
239 |
taggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| |||||| ||||| |
|
|
| T |
5635208 |
taggacaatgcattattatatgcaggggtcggggttcaaaccccggacac |
5635257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 280
Target Start/End: Complemental strand, 13073245 - 13073188
Alignment:
| Q |
224 |
gcttagctaaattggtaggacaatgcattattatatgcaggg-ccggggttcgaaccc |
280 |
Q |
| |
|
||||| || |||||||| ||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
13073245 |
gcttatctcaattggtatgacaatgcattattatatgtagggatcggggttcgaaccc |
13073188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 332
Target Start/End: Original strand, 20610828 - 20610861
Alignment:
| Q |
299 |
aaggtaaattctagccactagactacctgaccaa |
332 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
20610828 |
aaggtgaattctagccactagactacctgaccaa |
20610861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 287
Target Start/End: Complemental strand, 34773759 - 34773710
Alignment:
| Q |
239 |
taggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||| |||| | |||||||||||| ||||| |
|
|
| T |
34773759 |
taggacaatgcattattatatgcaggggctgaggttcgaaccccggacac |
34773710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 281
Target Start/End: Original strand, 36008296 - 36008337
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
36008296 |
ggacaatgcattgttatatgcaggggccggggttcgaacccc |
36008337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 287
Target Start/End: Original strand, 38433330 - 38433379
Alignment:
| Q |
239 |
taggacaatgcattattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||| ||||||||||||||||| |
|
|
| T |
38433330 |
taggacaatgcattattatatgtaggagtcggagttcgaaccccagacac |
38433379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 265
Target Start/End: Original strand, 44074869 - 44074898
Alignment:
| Q |
236 |
tggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44074869 |
tggtaggacaatgcattattatatgcaggg |
44074898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 45350291 - 45350344
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||| ||||||||||||||||| || ||| ||||||||||| ||||| |
|
|
| T |
45350291 |
ttggtaggacagtgcattattatatgcagaggtcggagttcgaaccccggacac |
45350344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 45359770 - 45359823
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||| ||||||||||||||||| || ||| ||||||||||| ||||| |
|
|
| T |
45359770 |
ttggtaggacagtgcattattatatgcagaggtcggagttcgaaccccggacac |
45359823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 46482897 - 46482852
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagg-gccggggttcgaacc |
279 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||| ||||||||| |
|
|
| T |
46482897 |
ttggtaggacaatacattattatatgcaggagccggtgttcgaacc |
46482852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 287
Target Start/End: Original strand, 52031230 - 52031275
Alignment:
| Q |
243 |
acaatgcattattatatgcagggc-cggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
52031230 |
acaatgcattagtatatgcaggggtcggggttcgaaccccagacac |
52031275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 52608647 - 52608594
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||| ||||||||||| ||||| |
|
|
| T |
52608647 |
ttggtaggacaatgcattattatatgcatggatcggagttcgaaccccggacac |
52608594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 267
Target Start/End: Original strand, 30369361 - 30369393
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggcc |
267 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
30369361 |
ttggtaggacaatgcattgttatatgcagggcc |
30369393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 243 - 287
Target Start/End: Original strand, 34106625 - 34106669
Alignment:
| Q |
243 |
acaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
34106625 |
acaatgcattattatatgcagaggtcgggttcgaaccccagacac |
34106669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 233 - 265
Target Start/End: Complemental strand, 35451203 - 35451171
Alignment:
| Q |
233 |
aattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
35451203 |
aattggtatgacaatgcattattatatgcaggg |
35451171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 287
Target Start/End: Complemental strand, 37032254 - 37032206
Alignment:
| Q |
240 |
aggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||| ||| |||| |||||||||| ||||| |
|
|
| T |
37032254 |
aggacaatgcattattatatgcaggggtcgggattcgaaccccggacac |
37032206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 40200836 - 40200792
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaac |
278 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
40200836 |
ttggtaggacaatgcattattatatgcatgatccggggttcgaac |
40200792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 233 - 265
Target Start/End: Complemental strand, 49280751 - 49280719
Alignment:
| Q |
233 |
aattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
49280751 |
aattggtaggacaatgaattattatatgcaggg |
49280719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 287
Target Start/End: Complemental strand, 56531311 - 56531263
Alignment:
| Q |
240 |
aggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| || ||||| |
|
|
| T |
56531311 |
aggacaatgcattgttatatgcaggggccggggttcgaactccggacac |
56531263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 47)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 235 - 332
Target Start/End: Complemental strand, 4798621 - 4798516
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||| ||||| ||| | ||| |||||| |||||||||||||||||||||| |
|
|
| T |
4798621 |
ttggtaggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcaccttgtaaggtgaattctagccactagactacct |
4798522 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
4798521 |
gaccaa |
4798516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 9524972 - 9525025
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9524972 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacac |
9525025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 24608563 - 24608510
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24608563 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacac |
24608510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 15042445 - 15042392
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
15042445 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
15042392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 235 - 281
Target Start/End: Original strand, 43847717 - 43847764
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43847717 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaacccc |
43847764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 238 - 287
Target Start/End: Complemental strand, 10199819 - 10199769
Alignment:
| Q |
238 |
gtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
10199819 |
gtaggacaatgcattattatatgcaggggccggggttcgaaccccaaacac |
10199769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 235 - 329
Target Start/End: Complemental strand, 23857404 - 23857301
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca--gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacc |
325 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| | ||||| ||| ||||| || ||| ||||||||||||||| ||||| |
|
|
| T |
23857404 |
ttggtaggacaatgcattattatatgcagggggccggggttcgaacctcggacacccgacttattcatcttatacggtgaattctagccactaggctacc |
23857305 |
T |
 |
| Q |
326 |
tgac |
329 |
Q |
| |
|
|||| |
|
|
| T |
23857304 |
tgac |
23857301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 233 - 329
Target Start/End: Original strand, 25119221 - 25119325
Alignment:
| Q |
233 |
aattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagaca-------cattgatcttttaaggtaaattctagccactagactac |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |||| | ||| ||| ||||||||||||||||| ||||| |
|
|
| T |
25119221 |
aattggtaggacaatgcattattatatgcaggggttggggttcgaaccccggacatcccactcattcaccttgtaatgtaaattctagccactaaactac |
25119320 |
T |
 |
| Q |
325 |
ctgac |
329 |
Q |
| |
|
||||| |
|
|
| T |
25119321 |
ctgac |
25119325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 323
Target Start/End: Original strand, 6064381 - 6064488
Alignment:
| Q |
224 |
gcttagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagcca |
315 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||| ||| ||||||||||||| | ||||| ||| | ||| |||||| ||||||||||| |
|
|
| T |
6064381 |
gcttagctcaattggttggacaatgcattattatatgcaggggtcggggttcgaacctcggacacttcacttattcagcttataaggtgaattctagcca |
6064480 |
T |
 |
| Q |
316 |
ctagacta |
323 |
Q |
| |
|
|||||||| |
|
|
| T |
6064481 |
ctagacta |
6064488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 17980297 - 17980350
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
17980297 |
ttggtaggacaaagcattattatatgcaggggccggggttcgaaccccggacac |
17980350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 30942681 - 30942632
Alignment:
| Q |
233 |
aattggtaggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30942681 |
aattgataggacaatgcattattatatgcaggggccggggttcgaacccc |
30942632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 235 - 279
Target Start/End: Original strand, 7649544 - 7649588
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaacc |
279 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
7649544 |
ttggtaggacaatgcattattatatgtagggctggggttcgaacc |
7649588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 2696554 - 2696601
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
2696554 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
2696601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 2800040 - 2800087
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
2800040 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
2800087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 239 - 281
Target Start/End: Original strand, 8034549 - 8034592
Alignment:
| Q |
239 |
taggacaatgcattattatatgcagg-gccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8034549 |
taggacaatgcattattatatgcaggagccggggttcgaacccc |
8034592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 243 - 286
Target Start/End: Original strand, 14683900 - 14683943
Alignment:
| Q |
243 |
acaatgcattattatatgcagggccggggttcgaaccccagaca |
286 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
14683900 |
acaatgcattattatatgcagggtcggggttcgaaccccggaca |
14683943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 39484450 - 39484407
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaa |
277 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39484450 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaa |
39484407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 241 - 286
Target Start/End: Original strand, 4293904 - 4293950
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagaca |
286 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
4293904 |
ggacaatgcattattatatgcaggggtcggggttcgaaccccagaca |
4293950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 17987529 - 17987476
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
17987529 |
ttggtaggataatgcattattatatgcaggggccggagttcgaaccccggacac |
17987476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 243 - 287
Target Start/End: Complemental strand, 21133591 - 21133546
Alignment:
| Q |
243 |
acaatgcattattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
21133591 |
acaatgcattattatatgcaggagtcggggttcgaaccccagacac |
21133546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 241 - 287
Target Start/End: Complemental strand, 38790647 - 38790599
Alignment:
| Q |
241 |
ggacaatgcattattatatgcaggg--ccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
38790647 |
ggacaatgcattattatatgcaggggccgggggttcgaaccccagacac |
38790599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 233 - 265
Target Start/End: Original strand, 2376531 - 2376563
Alignment:
| Q |
233 |
aattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2376531 |
aattggtaggacaatgcattattatatgcaggg |
2376563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 279
Target Start/End: Original strand, 1588788 - 1588827
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1588788 |
ggacaatgcattattatatgcaggggccggggttcgaacc |
1588827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 243 - 332
Target Start/End: Complemental strand, 13537383 - 13537286
Alignment:
| Q |
243 |
acaatgcattattatatgcagg-gccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacctgaccaa |
332 |
Q |
| |
|
|||||||||| ||||||||||| | ||||||||||||||||||||| ||| ||||| |||||| |||| ||||||||| ||||| ||||||| |
|
|
| T |
13537383 |
acaatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttattcatcttataaggtgaattgtagccactaaactacttgaccaa |
13537286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 243 - 332
Target Start/End: Complemental strand, 13626931 - 13626834
Alignment:
| Q |
243 |
acaatgcattattatatgcagg-gccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacctgaccaa |
332 |
Q |
| |
|
|||||||||| ||||||||||| | ||||||||||||||||||||| ||| ||||| |||||| |||| ||||||||| ||||| ||||||| |
|
|
| T |
13626931 |
acaatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttattcatcttataaggtgaattgtagccactaaactacttgaccaa |
13626834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 26703970 - 26703927
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgc-agggccggggttcgaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
26703970 |
ttggtaggacaatgcattattatatgcaagggtcggggttcgaa |
26703927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 280
Target Start/End: Complemental strand, 5184967 - 5184921
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccc |
280 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
5184967 |
ttggtaggacaatggattattatatgcaggggctggggttcgaaccc |
5184921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Complemental strand, 7540568 - 7540538
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7540568 |
ttggtaggacaatgcattattatatgcaggg |
7540538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Complemental strand, 13762592 - 13762562
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13762592 |
ttggtaggacaatgcattattatatgcaggg |
13762562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 246 - 287
Target Start/End: Original strand, 26657882 - 26657924
Alignment:
| Q |
246 |
atgcattattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
26657882 |
atgcattgttatatgcagggaccggggttcgaaccccagacac |
26657924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 28465633 - 28465663
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28465633 |
ttggtaggacaatgcattattatatgcaggg |
28465663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Complemental strand, 41089230 - 41089200
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41089230 |
ttggtaggacaatgcattattatatgcaggg |
41089200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 277
Target Start/End: Complemental strand, 18009789 - 18009752
Alignment:
| Q |
241 |
ggacaatgcattattatatgcaggg-ccggggttcgaa |
277 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18009789 |
ggacaatgcattattatatgcagggtccggggttcgaa |
18009752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 25689468 - 25689415
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||| |||||||||||| ||||| |
|
|
| T |
25689468 |
ttggtaggacactgcattattatatgtaggggccgaggttcgaaccccggacac |
25689415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 34631999 - 34632052
Alignment:
| Q |
225 |
cttagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaa |
277 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
34631999 |
cttagctcgattggttggacaatgcattattatatgcaggggccggtgttcgaa |
34632052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 292 - 329
Target Start/End: Original strand, 39258660 - 39258697
Alignment:
| Q |
292 |
atcttttaaggtaaattctagccactagactacctgac |
329 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
39258660 |
atcttataaggtaaattctagccactaggctacctgac |
39258697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 44136357 - 44136304
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||| ||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
44136357 |
ttggtaggacaatatattattatatgcaggggctgaggttcgaaccccagacac |
44136304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Original strand, 1503944 - 1503980
Alignment:
| Q |
252 |
tattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1503944 |
tattatatgcaggagccggggttcgaaccccagacac |
1503980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 2386082 - 2386046
Alignment:
| Q |
18 |
aaatgaaagaaagaaaacaacaattttaccaaattaa |
54 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| |
|
|
| T |
2386082 |
aaatgaaagaaagagaataacaattttaccaaattaa |
2386046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 242 - 281
Target Start/End: Original strand, 5323944 - 5323984
Alignment:
| Q |
242 |
gacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
5323944 |
gacaatgcattattatatgcaggggtcggggttcgaacccc |
5323984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Original strand, 7765678 - 7765714
Alignment:
| Q |
252 |
tattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7765678 |
tattatatgcaggagccggggttcgaaccccagacac |
7765714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 244 - 287
Target Start/End: Complemental strand, 13702423 - 13702379
Alignment:
| Q |
244 |
caatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
13702423 |
caatgcattattatatgcaggggtcggggttcgaacctcagacac |
13702379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Original strand, 26022282 - 26022318
Alignment:
| Q |
252 |
tattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26022282 |
tattatatgcaggggccggggttcgaaccccagacac |
26022318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 263
Target Start/End: Complemental strand, 40249960 - 40249932
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40249960 |
ttggtaggacaatgcattattatatgcag |
40249932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 41793060 - 41793005
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcagg-gccggggttcgaacccca |
282 |
Q |
| |
|
||||| |||||| |||||| |||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
41793060 |
tagctcaattggcaggaca-tgcattgttatatgcaggagccggggttcgaacccca |
41793005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 42761945 - 42761901
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaac |
278 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
42761945 |
ttggtatgacaatgcattattatatgcagggggcggggttcgaac |
42761901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 297 - 329
Target Start/End: Complemental strand, 42762042 - 42762010
Alignment:
| Q |
297 |
ttaaggtaaattctagccactagactacctgac |
329 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
42762042 |
ttaaggtgaattctagccactagactacctgac |
42762010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 48)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 227 - 332
Target Start/End: Complemental strand, 22966046 - 22965933
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccacta |
318 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||| | ||| |||||| ||||||| |||||| |
|
|
| T |
22966046 |
tagctcaattggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcaccttataaggtgaattctaaccacta |
22965947 |
T |
 |
| Q |
319 |
gactacctgaccaa |
332 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
22965946 |
gactacatgaccaa |
22965933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 235 - 332
Target Start/End: Original strand, 30644184 - 30644289
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||| | ||| |||||| ||||||||||||||| ||||| |
|
|
| T |
30644184 |
ttggtaggacaatgcattattatatgcaggggccggtgttcgaaccccagacaccccacttattcaccttataaggtgaattctagccactagtctaccg |
30644283 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
30644284 |
gaccaa |
30644289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 227 - 287
Target Start/End: Complemental strand, 2261572 - 2261511
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
2261572 |
tagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaatcccggacac |
2261511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 227 - 287
Target Start/End: Original strand, 5787468 - 5787529
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||| |||||||| |||| |
|
|
| T |
5787468 |
tagctcaattggtaggacaatgcattattatatgcaggggccggggtttgaaccccaaacac |
5787529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 239 - 287
Target Start/End: Complemental strand, 23685630 - 23685581
Alignment:
| Q |
239 |
taggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23685630 |
taggacaatgcattattatatgcaggggccggggttcgaaccccagacac |
23685581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 47552228 - 47552281
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgc-agggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
47552228 |
ttggtaggacaatgcattattatatgcaagggccggggttcgaaccccggacac |
47552281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 238 - 332
Target Start/End: Complemental strand, 44437902 - 44437809
Alignment:
| Q |
238 |
gtaggacaatgcattattatatgca-gggccggggttcgaaccccagacacattgatcttttaaggtaaattctagccactagactacctgaccaa |
332 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||| |||| | ||||||||||||||| |||||||||||| |
|
|
| T |
44437902 |
gtaggacaatgcattattatatgcaggggccggggttcgaaccccggacac--cccacttataagatgaattctagccactaggctacctgaccaa |
44437809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 235 - 332
Target Start/End: Original strand, 34948121 - 34948226
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||| |||||||||||| ||||| ||| | ||| |||||| ||||||||||||||| |||||| |
|
|
| T |
34948121 |
ttggtaggacaatgcattatcatatgcagtggccgaggttcgaaccccggacaccccacttattcaccttataaggtgaattctagccactaggctacct |
34948220 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
34948221 |
gaccaa |
34948226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 235 - 281
Target Start/End: Complemental strand, 8725217 - 8725171
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8725217 |
ttggtaggacgatgcattattatatgcaggaccggggttcgaacccc |
8725171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 27047795 - 27047750
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27047795 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaacc |
27047750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 281
Target Start/End: Complemental strand, 17900959 - 17900912
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
17900959 |
ttggtaggacaatgcattattatatgcaggggccggggctcgaacccc |
17900912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 329
Target Start/End: Complemental strand, 14967714 - 14967611
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac--------attgatcttttaaggtaaattctagccactagactacc |
325 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| ||||||| ||||| ||||||| ||| | ||| |||||| ||||||||||||||||||||| |
|
|
| T |
14967714 |
ttggtaggacaatgcattattatatgtaggggtcggggtttgaacctcagacacctcactttattcaacttataaggtgaattctagccactagactacc |
14967615 |
T |
 |
| Q |
326 |
tgac |
329 |
Q |
| |
|
|||| |
|
|
| T |
14967614 |
tgac |
14967611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 329
Target Start/End: Complemental strand, 15397190 - 15397087
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac--------attgatcttttaaggtaaattctagccactagactacc |
325 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| ||||||| ||||| ||||||| ||| | ||| |||||| ||||||||||||||||||||| |
|
|
| T |
15397190 |
ttggtaggacaatgcattattatatgtaggggtcggggtttgaacctcagacacctcactttattcaacttataaggtgaattctagccactagactacc |
15397091 |
T |
 |
| Q |
326 |
tgac |
329 |
Q |
| |
|
|||| |
|
|
| T |
15397090 |
tgac |
15397087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 328
Target Start/End: Complemental strand, 29710180 - 29710080
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacctg |
327 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | ||||||||| | |||||| ||| ||||| |||||| |||||||||||||| ||||||| |
|
|
| T |
29710180 |
ttggtaggacaatgcattattatatgtagggctgaggttcgaactctagacactccacttattcatcttataaggtgaattctagccactaagctacctg |
29710081 |
T |
 |
| Q |
328 |
a |
328 |
Q |
| |
|
| |
|
|
| T |
29710080 |
a |
29710080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 280
Target Start/End: Complemental strand, 46337948 - 46337902
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg-ccggggttcgaaccc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46337948 |
ttggtaggacaatgcattattatatgcagggatcggggttcgaaccc |
46337902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 280
Target Start/End: Original strand, 46716348 - 46716394
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaaccc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
46716348 |
ttggtaggacaatgcattattatatgcagaggtcggggttcgaaccc |
46716394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 287
Target Start/End: Original strand, 24479590 - 24479651
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
24479590 |
tagctcaattggtaggacagtgcattattatatggaggggctggggttcgaaccccggacac |
24479651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 36316054 - 36316009
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36316054 |
ttggtaggataatgcattattatatgcaggggccggggttcgaacc |
36316009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 241 - 332
Target Start/End: Original strand, 38451884 - 38451983
Alignment:
| Q |
241 |
ggacaatgcattattatatgcaggg-ccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacctgaccaa |
332 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||| ||| ||||| ||| | || |||||| |||||||||||||||||||||||||||| |
|
|
| T |
38451884 |
ggacaatgcattgttatatgcaggggccggggttcgaatcccggacaccccacttattcacattataaggtgaattctagccactagactacctgaccaa |
38451983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 45011738 - 45011693
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaacc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
45011738 |
ttggtaggacaatgcattattatatgcagaggccagggttcgaacc |
45011693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 242 - 332
Target Start/End: Complemental strand, 29658345 - 29658247
Alignment:
| Q |
242 |
gacaatgcattattatatgcaggg-ccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacctgaccaa |
332 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||| ||||| ||| | ||| |||||| ||||||||||||||| |||| ||||||| |
|
|
| T |
29658345 |
gacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaattctagccactaggctacttgaccaa |
29658247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 286
Target Start/End: Complemental strand, 38778759 - 38778707
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagaca |
286 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||| |||||| |||| |
|
|
| T |
38778759 |
ttggtaggacaatgcattattatatgcaggggccgaggttctaaccccggaca |
38778707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 4818035 - 4818089
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgc--agggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||| |||||||| |
|
|
| T |
4818035 |
ttggtaggacaatgcattattatatgcggggggccgtggttcgaactccagacac |
4818089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 8195930 - 8195973
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaa |
277 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
8195930 |
ttggtaggacaatgcattattatatccaggggccggggttcgaa |
8195973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 246 - 289
Target Start/End: Complemental strand, 8903863 - 8903820
Alignment:
| Q |
246 |
atgcattattatatgcagggccggggttcgaaccccagacacat |
289 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8903863 |
atgcattgttatatgcaggatcggggttcgaaccccagacacat |
8903820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Complemental strand, 21285427 - 21285380
Alignment:
| Q |
241 |
ggacaatgcattattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
21285427 |
ggacaatgcattgttatatgcaggggccggggttcgaaccccggacac |
21285380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Complemental strand, 4590686 - 4590656
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4590686 |
ttggtaggacaatgcattattatatgcaggg |
4590656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 246 - 287
Target Start/End: Original strand, 7465492 - 7465534
Alignment:
| Q |
246 |
atgcattattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
7465492 |
atgcattattatatgcaggggccggggttcgaaccccggacac |
7465534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 21086119 - 21086149
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21086119 |
ttggtaggacaatgcattattatatgcaggg |
21086149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 22047535 - 22047565
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22047535 |
ttggtaggacaatgcattattatatgcaggg |
22047565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 299 - 329
Target Start/End: Complemental strand, 24440945 - 24440915
Alignment:
| Q |
299 |
aaggtaaattctagccactagactacctgac |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24440945 |
aaggtaaattctagccactagactacctgac |
24440915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Complemental strand, 27907976 - 27907946
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
27907976 |
ttggtaggacaatgcattattatatgcaggg |
27907946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 265
Target Start/End: Original strand, 29778988 - 29779026
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29778988 |
tagctcaattggtaggataatgcattattatatgcaggg |
29779026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 281
Target Start/End: Original strand, 30152745 - 30152803
Alignment:
| Q |
224 |
gcttagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||| | ||| ||||||||||||||| |
|
|
| T |
30152745 |
gcttagctcagttggtaggacaatgcattattatatataggggtcggggttcgaacccc |
30152803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 287
Target Start/End: Original strand, 2366376 - 2366425
Alignment:
| Q |
239 |
taggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||| | |||||| |
|
|
| T |
2366376 |
taggacaatgcattattatatgcaggggtcggggttcgaactctagacac |
2366425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 277
Target Start/End: Complemental strand, 27957675 - 27957634
Alignment:
| Q |
237 |
ggtaggacaatgcattattatatgc-agggccggggttcgaa |
277 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
27957675 |
ggtaggacaatgtattattatatgcaagggccggggttcgaa |
27957634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 287
Target Start/End: Complemental strand, 34960992 - 34960947
Alignment:
| Q |
243 |
acaatgcattattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
34960992 |
acaatgcattattatatgcaggagccggggttcgaatcccggacac |
34960947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 286
Target Start/End: Original strand, 47355835 - 47355876
Alignment:
| Q |
246 |
atgcattattatatgcaggg-ccggggttcgaaccccagaca |
286 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
47355835 |
atgcattgttatatgcaggggccggggttcgaaccccagaca |
47355876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 224 - 287
Target Start/End: Original strand, 11808042 - 11808106
Alignment:
| Q |
224 |
gcttagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
11808042 |
gcttagctcaattggtagggacatgcattgttatatgcaggggtcggggttcgaaccccggacac |
11808106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Complemental strand, 12640624 - 12640588
Alignment:
| Q |
252 |
tattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12640624 |
tattatatgcaggagccggggttcgaaccccagacac |
12640588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 227 - 259
Target Start/End: Original strand, 21925482 - 21925514
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatat |
259 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
21925482 |
tagctcaattggtaggacaatgcattattatat |
21925514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 263
Target Start/End: Original strand, 22741218 - 22741246
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22741218 |
ttggtaggacaatgcattattatatgcag |
22741246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Complemental strand, 30388542 - 30388506
Alignment:
| Q |
252 |
tattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30388542 |
tattatatgcaggggccggggttcgaaccccagacac |
30388506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 241 - 288
Target Start/End: Original strand, 30566524 - 30566572
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacaca |
288 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
30566524 |
ggacaatgcattgttatatgtaagggccggggttcgaaccccggacaca |
30566572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 227 - 279
Target Start/End: Complemental strand, 30748053 - 30748001
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcagggccggggttcgaacc |
279 |
Q |
| |
|
||||| |||||||| || | |||||||||||||||| ||||||| |||||||| |
|
|
| T |
30748053 |
tagctcaattggtatgatactgcattattatatgcaaggccgggattcgaacc |
30748001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 263
Target Start/End: Complemental strand, 34962052 - 34962024
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34962052 |
ttggtaggacaatgcattattatatgcag |
34962024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 246 - 281
Target Start/End: Original strand, 35195869 - 35195905
Alignment:
| Q |
246 |
atgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35195869 |
atgcattattatatgcaggggccggggttcgaacccc |
35195905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Original strand, 48719834 - 48719870
Alignment:
| Q |
252 |
tattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48719834 |
tattatatgcaggagccggggttcgaaccccagacac |
48719870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 5e-16; HSPs: 45)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 235 - 332
Target Start/End: Complemental strand, 43566876 - 43566771
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||| ||||||| ||| | ||| |||||| ||||||||||||||| |||||| |
|
|
| T |
43566876 |
ttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcagacaccccacttattcaccttataaggtgaattctagccactaggctacct |
43566777 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
43566776 |
gaccaa |
43566771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 23820644 - 23820697
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
23820644 |
ttggtaggacaatgcattattatatgcaggggccggagttcgaaccccagacac |
23820697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 235 - 330
Target Start/End: Original strand, 33206772 - 33206875
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||| ||||| ||| | ||| |||||| ||||||||||||||| |||||| |
|
|
| T |
33206772 |
ttggtaggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattcaccttataaggtgaattctagccactaggctacct |
33206871 |
T |
 |
| Q |
327 |
gacc |
330 |
Q |
| |
|
|||| |
|
|
| T |
33206872 |
gacc |
33206875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 238 - 332
Target Start/End: Complemental strand, 24751337 - 24751244
Alignment:
| Q |
238 |
gtaggacaatgcattattatatgca-gggccggggttcgaaccccagacacattgatcttttaaggtaaattctagccactagactacctgaccaa |
332 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||| |||| | ||||||||||||||| |||||||||||| |
|
|
| T |
24751337 |
gtaggacaatgcattattatatgcaggggccggggttcgaaccccggacac--cccacttataagatgaattctagccactaggctacctgaccaa |
24751244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 235 - 279
Target Start/End: Original strand, 53467964 - 53468008
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaacc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53467964 |
ttggtaggacaatgcattattatatgcaggggcggggttcgaacc |
53468008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 332
Target Start/End: Original strand, 14417875 - 14417988
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccacta |
318 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||| || ||||||||||| ||||| ||| | ||| |||||| |||||||||||||| |
|
|
| T |
14417875 |
tagctcaattggtaggacaatgcattattatatgcaggggctggagttcgaaccccggacaccccacttattcaccttataaggtgaattctagccacta |
14417974 |
T |
 |
| Q |
319 |
gactacctgaccaa |
332 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14417975 |
agctacctgaccaa |
14417988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 235 - 281
Target Start/End: Original strand, 20244149 - 20244196
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20244149 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaacccc |
20244196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 238 - 326
Target Start/End: Original strand, 35483287 - 35483383
Alignment:
| Q |
238 |
gtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||| ||| ||||| ||| | ||| ||||||||||||||||||||||||||||| |
|
|
| T |
35483287 |
gtaggacaatgcattattatatgcaggggtcggggttcgaatcccggacaccccacttattcaccttataaggtaaattctagccactagactacct |
35483383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 235 - 332
Target Start/End: Complemental strand, 36727542 - 36727438
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacctg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||| | ||||| ||| ||||| |||||| |||||||||||||| |||||| |
|
|
| T |
36727542 |
ttggtaggacaatgcattattatatgcaaggtcggggttcgaacctcggacaccccacttattcatcttataaggtgaattctagccactaagttacctg |
36727443 |
T |
 |
| Q |
328 |
accaa |
332 |
Q |
| |
|
||||| |
|
|
| T |
36727442 |
accaa |
36727438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 239 - 287
Target Start/End: Original strand, 39492840 - 39492889
Alignment:
| Q |
239 |
taggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
39492840 |
taggacaatgcattattatatgcatgggctggggttcgaaccccagacac |
39492889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 49146099 - 49146152
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
49146099 |
ttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccggacac |
49146152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 235 - 286
Target Start/End: Original strand, 38176069 - 38176121
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg-ccggggttcgaaccccagaca |
286 |
Q |
| |
|
|||||||||||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
38176069 |
ttggtaggacaatgcaatattatatgctggggccggggttcgaaccccagaca |
38176121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 9625004 - 9625051
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
9625004 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
9625051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 332
Target Start/End: Complemental strand, 13540044 - 13539939
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| |||||||||||||| ||||| ||| | ||| |||||| ||||||||||| |||||||||| |
|
|
| T |
13540044 |
ttggtaggacaatgcattattatatgtaggggttggggttcgaaccccggacaccccacttatttaccttataaggtgaattctagccattagactacct |
13539945 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
13539944 |
gaccaa |
13539939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Complemental strand, 27183755 - 27183708
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
27183755 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
27183708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 285
Target Start/End: Original strand, 40786295 - 40786346
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagac |
285 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
40786295 |
ttggtaggacaatgcattattatatgcatgggtcggggttcgaacctcagac |
40786346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 281
Target Start/End: Original strand, 49639043 - 49639090
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
49639043 |
ttggtaggacaatgcattattatatgtaggggccggggttcgaacccc |
49639090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 329
Target Start/End: Original strand, 31698550 - 31698650
Alignment:
| Q |
237 |
ggtaggacaatgcattattatatgcagg-gccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacctga |
328 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||| | |||| ||| ||||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
31698550 |
ggtaggataatgcattattatatgcaggagccggggttcgaacctcgaacaccccacttattcatcttataaggtgaattctagccactagactatctga |
31698649 |
T |
 |
| Q |
329 |
c |
329 |
Q |
| |
|
| |
|
|
| T |
31698650 |
c |
31698650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Original strand, 34503230 - 34503272
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagg-gccggggttcga |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34503230 |
ttggtaggacaatgcattattatatgcaggagccggggttcga |
34503272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 241 - 281
Target Start/End: Original strand, 14868706 - 14868747
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14868706 |
ggacaatgcattattatatgcaggggccggggttcgaacccc |
14868747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 35849359 - 35849306
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||| | | |||||||||| ||||||| |
|
|
| T |
35849359 |
ttggtaggacaatgcattattatatgcagggactgtggttcgaacctcagacac |
35849306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 41121886 - 41121939
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||| |||||| ||||| |
|
|
| T |
41121886 |
ttggtaggacaatgcattattatatgcagaggtcggggttcaaaccccggacac |
41121939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 42271093 - 42271040
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||| || ||||| |
|
|
| T |
42271093 |
ttggtaggacaatgcattgttatatgcaggggccggggttcgaactccggacac |
42271040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 284
Target Start/End: Complemental strand, 7448437 - 7448393
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccaga |
284 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
7448437 |
ggacaatgcattattatatgcaggggccgggattcgaaccccaga |
7448393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 284
Target Start/End: Complemental strand, 7456579 - 7456535
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccaga |
284 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
7456579 |
ggacaatgcattattatatgcaggggccgggattcgaaccccaga |
7456535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 47062146 - 47062094
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||| ||||||||||| ||||| |
|
|
| T |
47062146 |
ttggtaggacaatgcattattatatgatgggtcggagttcgaaccccggacac |
47062094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 3955327 - 3955376
Alignment:
| Q |
241 |
ggacaatgcattattatatgca---gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
3955327 |
ggacaatgcattattatatgcaggggggccggggttcgaaccccggacac |
3955376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 281
Target Start/End: Original strand, 19540356 - 19540403
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagg-gccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
19540356 |
ttggtaggacaatacattattatatgcaggagctggggttcgaacccc |
19540403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 239 - 278
Target Start/End: Original strand, 33072309 - 33072348
Alignment:
| Q |
239 |
taggacaatgcattattatatgcagggccggggttcgaac |
278 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
33072309 |
taggacaatgcattattatatgcaggggccgggttcgaac |
33072348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Complemental strand, 36331800 - 36331753
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
36331800 |
ggacaatgcattattatatgcaggggtcggggttcgaaccccggacac |
36331753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 43774206 - 43774253
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
43774206 |
ggacaatgcattgttatatgcaggggtcggggttcgaaccccagacac |
43774253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 52030142 - 52030189
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
52030142 |
ggacaatgtattattatatgcaggggccggggttcgaaccccggacac |
52030189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 252 - 287
Target Start/End: Complemental strand, 54021369 - 54021334
Alignment:
| Q |
252 |
tattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54021369 |
tattatatgcagggccggagttcgaaccccagacac |
54021334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Complemental strand, 17440045 - 17440015
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17440045 |
ttggtaggacaatgcattattatatgcaggg |
17440015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Complemental strand, 32876196 - 32876166
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32876196 |
ttggtaggacaatgcattattatatgcaggg |
32876166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 286
Target Start/End: Original strand, 15498224 - 15498273
Alignment:
| Q |
238 |
gtaggacaatgcattattatatgca-gggccggggttcgaaccccagaca |
286 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
15498224 |
gtaggacaatgcattattatatgtaggggccggagttcgaaccccggaca |
15498273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 16006586 - 16006533
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||| |||||||||||| ||||||| | | ||||||||||||||||||||| |
|
|
| T |
16006586 |
ttggtagaacaatgcattataatatgcaagagtcggggttcgaaccccagacac |
16006533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 263
Target Start/End: Complemental strand, 21420278 - 21420241
Alignment:
| Q |
226 |
ttagctaaattggtaggacaatgcattattatatgcag |
263 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
21420278 |
ttagctcagttggtaggacaatgcattattatatgcag |
21420241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 264
Target Start/End: Original strand, 29507232 - 29507261
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29507232 |
ttggtaggacaatgcattattatatgcagg |
29507261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 281
Target Start/End: Original strand, 36476380 - 36476421
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
36476380 |
ggacaatgcattattatatgcaggggccggagttcgaacccc |
36476421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 45713495 - 45713548
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| |||||||| || ||||| |
|
|
| T |
45713495 |
ttggtaggacaatgcattattatatgtaggggccggagttcgaactccggacac |
45713548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 260
Target Start/End: Original strand, 53472631 - 53472664
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatg |
260 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
53472631 |
tagcttaattggtaggacaatgcattattatatg |
53472664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 286
Target Start/End: Original strand, 8475430 - 8475482
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaaccccagaca |
286 |
Q |
| |
|
|||||||||||||||||||| |||||||| || ||||||| ||| |||||||| |
|
|
| T |
8475430 |
ttggtaggacaatgcattatgatatgcagaggtcggggtttgaatcccagaca |
8475482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Original strand, 47098767 - 47098803
Alignment:
| Q |
252 |
tattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47098767 |
tattatatgcaggggccggggttcgaaccccagacac |
47098803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 263
Target Start/End: Original strand, 47427740 - 47427768
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47427740 |
ttggtaggacaatgcattattatatgcag |
47427768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 5e-16; HSPs: 55)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 235 - 332
Target Start/End: Complemental strand, 580863 - 580758
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||| | ||| |||| | ||||||||||||||| |||||| |
|
|
| T |
580863 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataagatgaattctagccactaggctacct |
580764 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
580763 |
gaccaa |
580758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 235 - 332
Target Start/End: Original strand, 17154664 - 17154769
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||| | ||| |||||| | ||||||||||||| |||||| |
|
|
| T |
17154664 |
ttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgagttctagccactaggctacct |
17154763 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
17154764 |
gaccaa |
17154769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 235 - 328
Target Start/End: Complemental strand, 20122555 - 20122454
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||| ||||| ||| ||||| |||||| ||||||||||||||| |||||| |
|
|
| T |
20122555 |
ttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacacgccacttattcatcttataaggtgaattctagccactaggctacct |
20122456 |
T |
 |
| Q |
327 |
ga |
328 |
Q |
| |
|
|| |
|
|
| T |
20122455 |
ga |
20122454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 10262754 - 10262807
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
10262754 |
ttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacac |
10262807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 30474275 - 30474222
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
30474275 |
ttggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacac |
30474222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 241 - 286
Target Start/End: Complemental strand, 32527151 - 32527105
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagaca |
286 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32527151 |
ggacaatgcattattatatgcaggggccggggttcgaaccccagaca |
32527105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 22297532 - 22297479
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
22297532 |
ttggtaggacaatgcattattatatgcaggggcaggggttcgaaccccggacac |
22297479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 283
Target Start/End: Complemental strand, 26807164 - 26807115
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccag |
283 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
26807164 |
ttggtaggacaatgcattattatatgcaggggccagggttcgaaccccag |
26807115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 235 - 286
Target Start/End: Complemental strand, 16028188 - 16028136
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaaccccagaca |
286 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||| ||||||| |
|
|
| T |
16028188 |
ttggtaggacaatgcattattatatgcagtggtcggggttcgaactccagaca |
16028136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 235 - 329
Target Start/End: Original strand, 34620533 - 34620635
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgc-agggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| ||||||||||||| ||| | ||| |||||| |||||||||||||||||||| | |
|
|
| T |
34620533 |
ttggtaggacaatgcattattatatgcaagggttggggtttgaaccccagacactctatttattcaccttataaggtgaattctagccactagactactt |
34620632 |
T |
 |
| Q |
327 |
gac |
329 |
Q |
| |
|
||| |
|
|
| T |
34620633 |
gac |
34620635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 329
Target Start/End: Complemental strand, 24034133 - 24034039
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacacattgatcttttaaggtaaattctagccactagactacctgac |
329 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||| | ||||| | | | || | || ||||||||||||||||||||||||| |
|
|
| T |
24034133 |
ttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcggacac-tccacttattcacgtgaattctagccactagactacctgac |
24034039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 29034997 - 29035044
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
29034997 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
29035044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 327
Target Start/End: Complemental strand, 8234872 - 8234772
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||||||||||| |||||||||||| | ||||||||||||||||||| ||||| ||| | ||| |||||| ||||||||||||||| |||||| |
|
|
| T |
8234872 |
ttggtaggacaatacattattatatgtaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaattctagccactaggctacct |
8234773 |
T |
 |
| Q |
327 |
g |
327 |
Q |
| |
|
| |
|
|
| T |
8234772 |
g |
8234772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 288
Target Start/End: Complemental strand, 25050320 - 25050266
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacaca |
288 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
25050320 |
ttggtaggataatgcattattatatgcaggggtcgggattcgaaccccagacaca |
25050266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 34034372 - 34034418
Alignment:
| Q |
241 |
ggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
34034372 |
ggacaatacattattatatgcaggaccggggttcgaaccccggacac |
34034418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 238 - 279
Target Start/End: Original strand, 36665448 - 36665490
Alignment:
| Q |
238 |
gtaggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36665448 |
gtaggacaatgcattattatatgcaggggccggggttcgaacc |
36665490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 287
Target Start/End: Complemental strand, 18386900 - 18386839
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| | |||| ||||||||||| || ||||| |
|
|
| T |
18386900 |
tagctcaattggtaggacaatgcattattatatgtaggggctggggttcgaactccggacac |
18386839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 36481084 - 36481137
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| || |||||||||||| |||| |
|
|
| T |
36481084 |
ttggtaggacaatgcattattatatgcatgggctggagttcgaaccccaaacac |
36481137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 36520860 - 36520807
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| ||||||||||||||| ||||| |
|
|
| T |
36520860 |
ttggtaggacaatgcattattatatgtaggggtcggggttcgaaccccggacac |
36520807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 44422122 - 44422175
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||| ||||| |
|
|
| T |
44422122 |
ttggtaggacaatgcattattatatgcagggatcggagttcgaaccccggacac |
44422175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 329
Target Start/End: Original strand, 3179339 - 3179441
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| || |||||||||| ||||||| ||| | ||| |||||| ||||||||||||||| |||||| |
|
|
| T |
3179339 |
ttggtagaacaatgcattattatatgcaggggtcgaggttcgaacctcagacaccccacttattcaccttataaggtgaattctagccactaggctacct |
3179438 |
T |
 |
| Q |
327 |
gac |
329 |
Q |
| |
|
||| |
|
|
| T |
3179439 |
gac |
3179441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 329
Target Start/End: Original strand, 7086268 - 7086370
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| |||||||||| |||| ||| | ||| |||||| ||||||| |||||||||||||| |
|
|
| T |
7086268 |
ttggtagggcaatgcattattatatgcaggggccgggattcgaaccccgaacaccccaattattcaccttataaggtgaattctaaccactagactacct |
7086367 |
T |
 |
| Q |
327 |
gac |
329 |
Q |
| |
|
||| |
|
|
| T |
7086368 |
gac |
7086370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 233 - 265
Target Start/End: Complemental strand, 19052693 - 19052661
Alignment:
| Q |
233 |
aattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19052693 |
aattggtaggacaatgcattattatatgcaggg |
19052661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 329
Target Start/End: Original strand, 32891296 - 32891398
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||| |||||||||| ||||| ||| ||||| |||| | ||||||||||||||| |||||| |
|
|
| T |
32891296 |
ttggtaggacaatgcattattatatgcaggggtcggttttcgaaccccggacaccccacttattcatcttataagatgaattctagccactaggctacct |
32891395 |
T |
 |
| Q |
327 |
gac |
329 |
Q |
| |
|
||| |
|
|
| T |
32891396 |
gac |
32891398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 287
Target Start/End: Original strand, 43870973 - 43871021
Alignment:
| Q |
240 |
aggacaatgcattattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
43870973 |
aggacaatgcattattatatgcaggagccggggttcgaatcccggacac |
43871021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 328
Target Start/End: Complemental strand, 2114515 - 2114414
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||||| |||||||||||||||||| | ||| ||||||||||||||| ||||| ||| | ||| |||||| ||||||||||||| |||||||| |
|
|
| T |
2114515 |
ttggtagaacaatgcattattatatgtaggggtcggggttcgaaccccggacacctcatttattcaccttataaggtgaattctagccactggactacct |
2114416 |
T |
 |
| Q |
327 |
ga |
328 |
Q |
| |
|
|| |
|
|
| T |
2114415 |
ga |
2114414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Complemental strand, 3037696 - 3037649
Alignment:
| Q |
241 |
ggacaatgcattattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
3037696 |
ggacaatgcattgttatatgcaggggccggggttcgaaccccggacac |
3037649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 9796918 - 9796965
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
9796918 |
ggacaatgcattattatatgcaggggtcggggttcgaaccccggacac |
9796965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 9802913 - 9802960
Alignment:
| Q |
241 |
ggacaatgcattattatatgc-agggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
9802913 |
ggacaatgcattattatatgcaagggtcggggttcgaaccccggacac |
9802960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 332
Target Start/End: Complemental strand, 19905735 - 19905630
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||| ||||||||||||||||||| || ||| ||||||||||||||| ||||| ||| | ||| |||||| ||||||||||| ||| |||||| |
|
|
| T |
19905735 |
ttggttggacaatgcattattatatacaggggtcggggttcgaaccccggacacccgacttattcaccttataaggtgaattctagccattaggctacct |
19905636 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
19905635 |
gaccaa |
19905630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 32943354 - 32943397
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
32943354 |
ttggtaggacaatgcattattatatgcagaggctggggttcgaa |
32943397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 328
Target Start/End: Complemental strand, 33001633 - 33001532
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgc-agggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| ||| ||| ||||| ||| ||||| |||||| ||||||||| ||||| |||||| |
|
|
| T |
33001633 |
ttggtaggacaatgcgttattatatgcaagggccggggtttgaatcccggacaccccacttattcatcttataaggtgaattctagctactaggctacct |
33001534 |
T |
 |
| Q |
327 |
ga |
328 |
Q |
| |
|
|| |
|
|
| T |
33001533 |
ga |
33001532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 245 - 287
Target Start/End: Original strand, 44187729 - 44187772
Alignment:
| Q |
245 |
aatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
44187729 |
aatgcattattatatgcaggggtcggggttcgaaccccagacac |
44187772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 265
Target Start/End: Complemental strand, 2558346 - 2558308
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
2558346 |
tagctcaattggtaggacaatgcattattatatgtaggg |
2558308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 319
Target Start/End: Original strand, 3364740 - 3364832
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactag |
319 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||| ||||||||| |||||| ||| |||||||||||| ||||||||||||||| |
|
|
| T |
3364740 |
ttggtaggacaatacattattatatgcaggggccgaggttcgaactttagacaccccacttattcatcttttaaggtgaattctagccactag |
3364832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 287
Target Start/End: Complemental strand, 17119507 - 17119448
Alignment:
| Q |
226 |
ttagctaaattggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||| | |||||||||||||| ||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
17119507 |
ttagcttagttggtaggacaatgtattattatatgca--gctggggttcgaaccccggacac |
17119448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 22538554 - 22538584
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22538554 |
ttggtaggacaatgcattattatatgcaggg |
22538584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 27495553 - 27495583
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
27495553 |
ttggtaggacaatgcattattatatgcaggg |
27495583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 241 - 329
Target Start/End: Original strand, 29664624 - 29664720
Alignment:
| Q |
241 |
ggacaatgcattattatatgcagggc-cggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacctgac |
329 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| || ||| ||||| ||| ||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
29664624 |
ggacaatgcattgttatatgcaggggtcggggttcaaatcccggacaccccacttattcatcttataaggtgaattctagccactagactacctgac |
29664720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 31564110 - 31564140
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31564110 |
ttggtaggacaatgcattattatatgcaggg |
31564140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 280
Target Start/End: Complemental strand, 42091354 - 42091308
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagg-gccggggttcgaaccc |
280 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
42091354 |
ttggtaggacaatgcattattatattcaggagccggagttcgaaccc |
42091308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 1836603 - 1836656
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
1836603 |
ttggtaggacaatgcattattatatgaaggaatcggggttcgaaccccggacac |
1836656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 4157729 - 4157676
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || || ||||||||||| ||||| |
|
|
| T |
4157729 |
ttggtaggacaatgcattattatatgtaggtgctggagttcgaaccccggacac |
4157676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 288
Target Start/End: Complemental strand, 17974883 - 17974838
Alignment:
| Q |
244 |
caatgcattattatatgcag-ggccggggttcgaaccccagacaca |
288 |
Q |
| |
|
||||||||| |||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
17974883 |
caatgcattgttatatgcagaggccgaggttcgaaccccagacaca |
17974838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 281
Target Start/End: Complemental strand, 21970513 - 21970472
Alignment:
| Q |
241 |
ggacaatgcattattatatgcaggg-ccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21970513 |
ggacaatgcattattatatgcagggatcggggttcgaacccc |
21970472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 287
Target Start/End: Original strand, 34830613 - 34830654
Alignment:
| Q |
246 |
atgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| || ||||| |
|
|
| T |
34830613 |
atgcattgttatatgcagggccggggttcgaactccggacac |
34830654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 38530286 - 38530245
Alignment:
| Q |
224 |
gcttagctaaattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||| ||||| |
|
|
| T |
38530286 |
gcttagctcagttggtaggacaatgcattattatatacaggg |
38530245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 44721784 - 44721739
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
44721784 |
ttggtagaacaatgcattattatatgcaggggtcggggttcgaacc |
44721739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 45523680 - 45523733
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||| || |||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
45523680 |
ttggtaggacaatgtataattatatgcaggggtcggggttcgaaccccaaacac |
45523733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Complemental strand, 8250336 - 8250300
Alignment:
| Q |
252 |
tattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8250336 |
tattatatgcaggggccggggttcgaaccccagacac |
8250300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 31956881 - 31956925
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaac |
278 |
Q |
| |
|
|||||||||||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
31956881 |
ttggtaggacaatgcattattatatgtaggggctggggttcgaac |
31956925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Original strand, 34355756 - 34355792
Alignment:
| Q |
252 |
tattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34355756 |
tattatatgcaggggccggggttcgaaccccagacac |
34355792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 35049229 - 35049185
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaacc |
279 |
Q |
| |
|
||||||| ||||||||||||||||| || || ||||||||||||| |
|
|
| T |
35049229 |
ttggtagaacaatgcattattatatacaaggtcggggttcgaacc |
35049185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Original strand, 36005477 - 36005513
Alignment:
| Q |
252 |
tattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36005477 |
tattatatgcaggagccggggttcgaaccccagacac |
36005513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 283
Target Start/End: Complemental strand, 40044154 - 40044110
Alignment:
| Q |
240 |
aggacaatgcattattatatgca-gggccggggttcgaaccccag |
283 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
40044154 |
aggacaatgtattattatatgcaggggtcggggttcgaaccccag |
40044110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 227 - 287
Target Start/End: Original strand, 5311 - 5371
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| | | ||||||||||| ||||| |
|
|
| T |
5311 |
tagctcaattggtaggacaatgcattattatatgcaggggccgtgttcgaaccccggacac |
5371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 33)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 9064887 - 9064934
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9064887 |
ggacaatgcattattatatgcaggggccggggttcgaaccccagacac |
9064934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 235 - 281
Target Start/End: Complemental strand, 10377204 - 10377157
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10377204 |
ttggtaggacaatgcattattatatgcagaggccggggttcgaacccc |
10377157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 235 - 332
Target Start/End: Original strand, 12089112 - 12089217
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||| ||||| ||| | ||| |||||| ||||||||||||||| ||||| |
|
|
| T |
12089112 |
ttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcaccttataaggtgaattctagccactaggatacct |
12089211 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
12089212 |
gaccaa |
12089217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 236 - 332
Target Start/End: Complemental strand, 25020607 - 25020503
Alignment:
| Q |
236 |
tggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacctg |
327 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||| ||||||||||||| ||||| ||| | ||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
25020607 |
tggtaggacgatgcattattatatgcaggggcctgggttcgaaccccggacaccccacttattcaccttataaggtgaattctagccactaggctacctg |
25020508 |
T |
 |
| Q |
328 |
accaa |
332 |
Q |
| |
|
||||| |
|
|
| T |
25020507 |
accaa |
25020503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 9491815 - 9491762
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
9491815 |
ttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacac |
9491762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 19642627 - 19642574
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
19642627 |
ttggtaggacaatgcattattatatgcatcggtcggggttcgaaccccagacac |
19642574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 235 - 329
Target Start/End: Complemental strand, 12127989 - 12127887
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||| |||||||||| ||||| ||| | ||| |||||| |||||||||||||||||||||| |
|
|
| T |
12127989 |
ttggtaggacaatgcattattatatgcaggggtcggaattcgaaccccggacacgccacttattcaccttataaggtgaattctagccactagactacct |
12127890 |
T |
 |
| Q |
327 |
gac |
329 |
Q |
| |
|
||| |
|
|
| T |
12127889 |
gac |
12127887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 235 - 332
Target Start/End: Complemental strand, 18904763 - 18904658
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||| | ||||| ||| | ||| |||||| ||||||||||||||| |||||| |
|
|
| T |
18904763 |
ttggtaggacaatgcattattatatgtatgggccggggttcgaactctggacaccccacttattcaccttataaggtgaattctagccactaggctacct |
18904664 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
18904663 |
gaccaa |
18904658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 280
Target Start/End: Complemental strand, 18244092 - 18244046
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaaccc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
18244092 |
ttggtaggacaatgcattattatatgcagaggtcggggttcgaaccc |
18244046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 265
Target Start/End: Original strand, 23771040 - 23771078
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23771040 |
tagctcaattggtaggacaatgcattattatatgcaggg |
23771078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 9438317 - 9438370
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
9438317 |
ttggtaggacaatgcattattatatgcaggggttggggttcgaaccccggacac |
9438370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 10373610 - 10373663
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
10373610 |
ttggtagaacaatgcattattatatgcaggggtcggggttcgaaccccggacac |
10373663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 12101901 - 12101954
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
12101901 |
ttggtaggacaatacattattatatgcaggggccggcgttcgaaccccggacac |
12101954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 239 - 287
Target Start/End: Original strand, 22983599 - 22983648
Alignment:
| Q |
239 |
taggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
22983599 |
taggacaatgtattattatatgcaggggccggggttcgaaccccggacac |
22983648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 239 - 287
Target Start/End: Complemental strand, 23804809 - 23804760
Alignment:
| Q |
239 |
taggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
23804809 |
taggacaatgtattattatatgcaggggccggggttcgaaccccggacac |
23804760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 279
Target Start/End: Original strand, 34365750 - 34365795
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
34365750 |
ttggtaggacaatgcattattatgtgcaggggccggggttcgaacc |
34365795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 6652225 - 6652277
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||| |||||||| |
|
|
| T |
6652225 |
ttggtaggacaatgcattattttatgcagggttagggttcgaactccagacac |
6652277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 280
Target Start/End: Complemental strand, 14981776 - 14981736
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccc |
280 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14981776 |
ggacaatgcattattatatgcaggggccggggttcgaaccc |
14981736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 329
Target Start/End: Original strand, 19165366 - 19165467
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag-ggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||| ||||| ||| | ||| |||||| ||||||||||||||| |||||| |
|
|
| T |
19165366 |
ttggtaggacaatgcattattatatgcagaggttggggttcgaacccc-gacaccccacttattcaccttataaggtgaattctagccactagtctacct |
19165464 |
T |
 |
| Q |
327 |
gac |
329 |
Q |
| |
|
||| |
|
|
| T |
19165465 |
gac |
19165467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 329
Target Start/End: Complemental strand, 22389830 - 22389728
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| | ||||||||| ||| ||||| ||| | ||| |||||| |||||||||| ||||||||||| |
|
|
| T |
22389830 |
ttggtaggacaatgcattattatatgcaggggtcagggttcgaatcccggacaccccacttattcaccttataaggtgaattctagccgctagactacct |
22389731 |
T |
 |
| Q |
327 |
gac |
329 |
Q |
| |
|
||| |
|
|
| T |
22389730 |
gac |
22389728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 287
Target Start/End: Complemental strand, 26598681 - 26598621
Alignment:
| Q |
227 |
tagctaaattggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||| | || ||||||| ||| |||| |
|
|
| T |
26598681 |
tagctcaattggtaggacaatgcattattatatgtaggggccggattcgaactccaaacac |
26598621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 279
Target Start/End: Original strand, 22501033 - 22501079
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg--ccggggttcgaacc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
22501033 |
ttggtaggacaatgcattattatatgcaggggtccgggattcgaacc |
22501079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 281
Target Start/End: Original strand, 24623537 - 24623584
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgc-agggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||| |||| |
|
|
| T |
24623537 |
ttggtaggacaatgcattattatatgcaagggtcggggttcgagcccc |
24623584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 332
Target Start/End: Original strand, 34396098 - 34396203
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac-------attgatcttttaaggtaaattctagccactagactacct |
326 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||| |||||||| || ||||| ||| | ||| |||||| ||||||| ||| |||||||||| |
|
|
| T |
34396098 |
ttggtacgacaatgcattattatatgcaggggccggagttcgaactccggacaccctatttattcaccttataaggtgaattctaaccaatagactacct |
34396197 |
T |
 |
| Q |
327 |
gaccaa |
332 |
Q |
| |
|
|||||| |
|
|
| T |
34396198 |
gaccaa |
34396203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Complemental strand, 5288425 - 5288395
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5288425 |
ttggtaggacaatgcattattatatgcaggg |
5288395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 236 - 281
Target Start/End: Original strand, 9424460 - 9424506
Alignment:
| Q |
236 |
tggtaggacaatgcattattatatgcag-ggccggggttcgaacccc |
281 |
Q |
| |
|
||||| ||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
9424460 |
tggtatgacaatgaattattatatgcagaggccggggttcgaacccc |
9424506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 239 - 284
Target Start/End: Original strand, 32057053 - 32057099
Alignment:
| Q |
239 |
taggacaatgcattattatatgcag-ggccggggttcgaaccccaga |
284 |
Q |
| |
|
||||||||||||||||||||||||| || || ||||||||||||||| |
|
|
| T |
32057053 |
taggacaatgcattattatatgcagtggtcgaggttcgaaccccaga |
32057099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 15289035 - 15288982
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||| |||||||||||||| | |||| ||||||||||| |||||||| |
|
|
| T |
15289035 |
ttggtaggacattgcattattatatgtaggggctggggttcgaactccagacac |
15288982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 233 - 280
Target Start/End: Complemental strand, 753394 - 753346
Alignment:
| Q |
233 |
aattggtaggacaatgcattattatatgca-gggccggggttcgaaccc |
280 |
Q |
| |
|
||||||||||||||| |||||||||||| | ||| |||||||||||||| |
|
|
| T |
753394 |
aattggtaggacaatacattattatatgtaggggtcggggttcgaaccc |
753346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 286
Target Start/End: Complemental strand, 6025466 - 6025414
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagaca |
286 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| |||| |||||||||| |||| |
|
|
| T |
6025466 |
ttggtaggataatgcattattatatgcaggggtcgggattcgaaccccggaca |
6025414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 15126258 - 15126310
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||| |||||||||||| |||| ||||||||||| || ||||| |
|
|
| T |
15126258 |
ttggtaggacaatacattattatatgtaggggaggggttcgaactccggacac |
15126310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 263
Target Start/End: Original strand, 30566073 - 30566101
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30566073 |
ttggtaggacaatgcattattatatgcag |
30566101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 241 - 280
Target Start/End: Complemental strand, 31949899 - 31949859
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccc |
280 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
31949899 |
ggacaatgcattattatatgcaggggtcggggttcgaaccc |
31949859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1990 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold1990
Description:
Target: scaffold1990; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Original strand, 909 - 962
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
909 |
ttggtaggacaatgcattattatatgcaggggctggggttcgaatcccagacac |
962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0092 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 47397 - 47344
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
47397 |
ttggtaggacaatgcattattatatgcaggggctggggttcgaatcccagacac |
47344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 43776 - 43732
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaacc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
43776 |
ttggtaggacaatgcattattatatgcaggactggggttcgaacc |
43732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 7097 - 7144
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
7097 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacac |
7144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 236 - 282
Target Start/End: Original strand, 101847 - 101894
Alignment:
| Q |
236 |
tggtaggacaatgcattattatatgca-gggccggggttcgaacccca |
282 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
101847 |
tggtaggataatgcattattatatgcaggggccggggttcgaacccca |
101894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 241 - 287
Target Start/End: Complemental strand, 4879 - 4833
Alignment:
| Q |
241 |
ggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
4879 |
ggacaatgcattattatatgcaggggcggggttcgaatcccggacac |
4833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 281
Target Start/End: Original strand, 16862 - 16908
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16862 |
ttggtaggacaatgcattattatatgcaggggtcgggttcgaacccc |
16908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0112 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0112
Description:
Target: scaffold0112; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 287
Target Start/End: Complemental strand, 18020 - 17958
Alignment:
| Q |
227 |
tagctaaattggtagg-acaatgcattattatatgcagggcc-ggggttcgaaccccagacac |
287 |
Q |
| |
|
||||| |||||||||| |||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
18020 |
tagctcaattggtagggacaatgcattgttatatgcaggggctggggttcgaaccccagacac |
17958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 236 - 281
Target Start/End: Complemental strand, 7097 - 7051
Alignment:
| Q |
236 |
tggtaggacaatgcattattatatgca-gggccggggttcgaacccc |
281 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
7097 |
tggtaggacaatgcattattatatgcaggggcgggggttcgaacccc |
7051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 235 - 279
Target Start/End: Original strand, 159029 - 159074
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgca-gggccggggttcgaacc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
159029 |
ttggtaggacaatgcattattatatgcaggggccgggtttcgaacc |
159074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 287
Target Start/End: Complemental strand, 37093 - 37041
Alignment:
| Q |
236 |
tggtaggacaatgcattattatatgcagg-gccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||| |||||| |
|
|
| T |
37093 |
tggtaggacaatgcattattatatccaggatccggggttcgaacccaagacac |
37041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 241 - 287
Target Start/End: Original strand, 25047 - 25094
Alignment:
| Q |
241 |
ggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
25047 |
ggacaatgcattattatatgcaggggctggggttcgaaccccggacac |
25094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 287
Target Start/End: Original strand, 4342 - 4391
Alignment:
| Q |
239 |
taggacaatgcattattatatgca-gggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||||| |||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
4342 |
taggacaatacattattatatgcaggggtcggggttcgaaccccggacac |
4391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 286
Target Start/End: Original strand, 16084 - 16132
Alignment:
| Q |
239 |
taggacaatgcattattatatgcaggg-ccggggttcgaaccccagaca |
286 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||| |||| |
|
|
| T |
16084 |
taggacaatgcattattatatgcagggatcggagttcgaaccccggaca |
16132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1086 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold1086
Description:
Target: scaffold1086; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 263
Target Start/End: Original strand, 2503 - 2531
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2503 |
ttggtaggacaatgcattattatatgcag |
2531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 287
Target Start/End: Original strand, 56358 - 56394
Alignment:
| Q |
252 |
tattatatgcaggg-ccggggttcgaaccccagacac |
287 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
56358 |
tattatatgcaggggccggggttcgaaccccagacac |
56394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 298 - 330
Target Start/End: Original strand, 49906 - 49938
Alignment:
| Q |
298 |
taaggtaaattctagccactagactacctgacc |
330 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
49906 |
taaggtgaattctagccactagactacctgacc |
49938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 235 - 287
Target Start/End: Complemental strand, 111777 - 111725
Alignment:
| Q |
235 |
ttggtaggacaatgcattattatatgcagggccggggttcgaaccccagacac |
287 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
111777 |
ttggtagaacaatacattattatatgcagggttgggattcgaaccccggacac |
111725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University