View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_40 (Length: 324)
Name: NF0913_low_40
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_40 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 104 - 293
Target Start/End: Complemental strand, 32597015 - 32596827
Alignment:
| Q |
104 |
tttagagtgatacatcttatgtatacattgagcacttgtacaaattgtaatctctccatttaactaggagagagggtggacaccttatacactattttat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32597015 |
tttagagtgatacatcttatgtatacattgagcacttgtacaaattgtaatttctccatgtaactaggagagagggtggacaccatatacactattttat |
32596916 |
T |
 |
| Q |
204 |
accacagactgagactacatttacaccctttcaagcaactaaacaaggagagagggtgagaccgtagaatggggtttccagcaaacatta |
293 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32596915 |
accacagactgagactacatttacaccc-ttcaagcaactaaacaaggagacagggtgagaccgtagaatggggtttccagcaaacatta |
32596827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 324
Target Start/End: Original strand, 24438406 - 24438446
Alignment:
| Q |
286 |
aaacattaggacacata--aaataaaaaacacaagtaataa |
324 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24438406 |
aaacattaggacacatataaaataaaaaacacaagtaataa |
24438446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 324
Target Start/End: Original strand, 24463636 - 24463676
Alignment:
| Q |
286 |
aaacattaggacacata--aaataaaaaacacaagtaataa |
324 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24463636 |
aaacattaggacacatataaaataaaaaacacaagtaataa |
24463676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University