View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_43 (Length: 323)
Name: NF0913_low_43
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 9e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 7588346 - 7588182
Alignment:
| Q |
1 |
tttgcatggatcaaaactatattttatcccaggaaaaagaaggnnnnnnnggtacttaccttcgtatttccttgaagtgataggaaggatccttctgtat |
100 |
Q |
| |
|
|||||| ||| ||||||||||||||| || ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7588346 |
tttgcagggaccaaaactatattttagcctaggaaaaagaaggaaaaaaaggtacttaccttcatatttccttgaagtgataggaaggatccttctgtat |
7588247 |
T |
 |
| Q |
101 |
ggaaagagaaagcaatgtttttacaggggttttttgggaattagaaatttgttttgaatatttta |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7588246 |
ggaaagagaaagcaatgtttttacaggggttttttgggaattagaaatttgttttgaatatttta |
7588182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 204 - 253
Target Start/End: Complemental strand, 7576176 - 7576127
Alignment:
| Q |
204 |
tcacttctatcagttggtaacaaaatcataaggtacatcatttcatctca |
253 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
7576176 |
tcacttctatcagttgataacaaagtcaacaggtacatcatttcatctca |
7576127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University