View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0913_low_44 (Length: 322)

Name: NF0913_low_44
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0913_low_44
NF0913_low_44
[»] chr7 (2 HSPs)
chr7 (102-229)||(31405662-31405788)
chr7 (246-286)||(31405637-31405677)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 102 - 229
Target Start/End: Complemental strand, 31405788 - 31405662
Alignment:
102 tgacgatgggagtattgatttatggctctttccatgaaacatcaattgtctcacgtgttataatttgtttaacaatcggaaatactataaggagtgcatg 201  Q
    ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31405788 tgacggtgggag-attgatttatggctctttccatgaaacatcaattgtctcacgtgttataatttgtttaacaatcggaaatactataaggagtgcatg 31405690  T
202 ttatctaggtaaagatgtttgtgagatt 229  Q
    ||||||||||||||||||||||||||||    
31405689 ttatctaggtaaagatgtttgtgagatt 31405662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 246 - 286
Target Start/End: Complemental strand, 31405677 - 31405637
Alignment:
246 agatgtttgtgagattttgaatttcttctccgtttgttgaa 286  Q
    |||||||||||||||||||||||||||||||||||||||||    
31405677 agatgtttgtgagattttgaatttcttctccgtttgttgaa 31405637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University