View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_44 (Length: 322)
Name: NF0913_low_44
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 102 - 229
Target Start/End: Complemental strand, 31405788 - 31405662
Alignment:
| Q |
102 |
tgacgatgggagtattgatttatggctctttccatgaaacatcaattgtctcacgtgttataatttgtttaacaatcggaaatactataaggagtgcatg |
201 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31405788 |
tgacggtgggag-attgatttatggctctttccatgaaacatcaattgtctcacgtgttataatttgtttaacaatcggaaatactataaggagtgcatg |
31405690 |
T |
|
| Q |
202 |
ttatctaggtaaagatgtttgtgagatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31405689 |
ttatctaggtaaagatgtttgtgagatt |
31405662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 246 - 286
Target Start/End: Complemental strand, 31405677 - 31405637
Alignment:
| Q |
246 |
agatgtttgtgagattttgaatttcttctccgtttgttgaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31405677 |
agatgtttgtgagattttgaatttcttctccgtttgttgaa |
31405637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 164 times since January 2019
Visitors: 6702