View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_54 (Length: 308)
Name: NF0913_low_54
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 30 - 241
Target Start/End: Original strand, 20488345 - 20488556
Alignment:
| Q |
30 |
aattgttgtggaagtaagcttctcattggcatgtctaagcttattctacctttgtatccattcctttcttctctcataatcttttgtgtgaaagttgagc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20488345 |
aattgttgtggaagtaagcttctcattggcatgtctaagcttattctacctttgtatccattcctttcttctctcataatcttttgtgtgaaagttgagc |
20488444 |
T |
|
| Q |
130 |
tattattgtatccaattacttcattgtatcctgagaagtatcttgatgcttcaaacacatcaagctcaccagaatcatttcttctgtggaaggatttctt |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20488445 |
tattattgtatccaataacttcattgtatcctgagaagtatcttgatgcttcgaacacatcaagctcaccagaatcatttcttctgtggaaggatttctt |
20488544 |
T |
|
| Q |
230 |
attgtggttcat |
241 |
Q |
| |
|
|||||||||||| |
|
|
| T |
20488545 |
attgtggttcat |
20488556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 80 times since January 2019
Visitors: 6700