View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_56 (Length: 305)
Name: NF0913_low_56
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0913_low_56 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 30 - 305
Target Start/End: Complemental strand, 28985829 - 28985554
Alignment:
Q |
30 |
cttaacgcgttggtcacgtgctattgtaggtgtggtaggatagaaattgcgagaaaggtgtttgatgaaatgacggagagagatatcgtgacttggaatg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28985829 |
cttaacgcgttggtcacgtgctattgtaggtgtggtaggatagaaattgcgagaaaggtgtttgatgaaatgacggagagagatatcgtgacttggaatg |
28985730 |
T |
 |
Q |
130 |
ctatgattggtggttattctcagagtggattttacaaagaatgtaagagattgtatttggagatgttgggtttagaagggaaagggattttgccgaatgc |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28985729 |
ctatgattggtggttattctcagagtggattttacgaagaatgtaagagattgtatttggagatgttgggtttagaagggaaagggattttgccgaatgc |
28985630 |
T |
 |
Q |
230 |
tgttacgattggtagtgtgatgcaggcgtgtggtcagtcgaaggatctttcctttggaatggaagttcatcgtttt |
305 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28985629 |
tgttacgattggtagtgtgatgcaggcgtgtggtcagtcgaaggatctttcctttggaatggaagttcatcgtttt |
28985554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University