View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_65 (Length: 287)
Name: NF0913_low_65
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_65 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 11 - 284
Target Start/End: Original strand, 5218493 - 5218766
Alignment:
| Q |
11 |
agaatattcacagtcaaaatactcaaaacaaattgtgtcaacggagaacacagcattggagatgagtgggatggatagaccaggcctactatcagaaata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5218493 |
agaatattcacagtcaaaatactcaaaacaaattgtgtcaacggagaacacagcattggagatgagtgggatggatagaccaggcctactatcagaaata |
5218592 |
T |
|
| Q |
111 |
tcagcggtgttggtgaacatgagctgcaatgtcacctcagcaacggcgtggacccacaatggaagggtggcctgcattctttacgtagaagaggcatcca |
210 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5218593 |
tcagcagtgttggtgaacatgagctgcaatgtcacctcagcaacggcgtggacccacaatggaagggtggcctgcattctttacgtagaagaggcatcca |
5218692 |
T |
|
| Q |
211 |
aacctggacccattagagacccaagacgattggcccaggtaaaggaacagctggagagtgttgtggtggcccat |
284 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5218693 |
aacctggacccattagagatccaagacgattggcccaggtaaaggaacagctggagagtgttgtggtggcccat |
5218766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 662 times since January 2019
Visitors: 6696