View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_69 (Length: 283)
Name: NF0913_low_69
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_69 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 56 - 243
Target Start/End: Original strand, 47492366 - 47492550
Alignment:
| Q |
56 |
ttaacaaagtaaccatatgaactttgtatatactatgccctatatatcatttatatcttacttttacattgtcctcaagtttcaaaattagaagatatat |
155 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
47492366 |
ttaacaaaggaaacatatgaactttgtatatactatgccctatataacatttatatcttacttttacattgtcctcaagtttgaaaattagaag----at |
47492461 |
T |
 |
| Q |
156 |
aggaaggaaggaatgagatatgct-agagaagataaagtcccaccattgtgcgccaatgacagttgaagctgccagcatgatctgtgct |
243 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47492462 |
aggaaggaaggaatgagatatgctaagagaagataaagtcccaccattgtgcgccaatgacagttgaagctgccagcatgatctgtgct |
47492550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University