View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_72 (Length: 277)
Name: NF0913_low_72
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 4 - 258
Target Start/End: Complemental strand, 18587808 - 18587550
Alignment:
| Q |
4 |
gtatttgtttatcattttgaattttgtaagttttgtgaatggaggcttttgtaagtgatgtgtatatttacctttacataatagatgatttgaattattc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18587808 |
gtatttgtttatcattttgaattttgtaagttttgtgaatggaggcttttgtaagtgatgt--atatttacctttacataatagatgatttgaattattc |
18587711 |
T |
 |
| Q |
104 |
cttttttaggctgaaataatatttctttctattatatatactttttaaacct------tagttgtattcttcatcgtgtttaatgaagatgggtgtgttg |
197 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||||||||| | || ||||||||||| |||||| |
|
|
| T |
18587710 |
cttttttgggctgaaataatatttctttctattatatatgctttttaagccttaattgtagttgtattcttcatctagattgatgaagatgggcgtgttg |
18587611 |
T |
 |
| Q |
198 |
gtgttgatatgatggtggataatcaatataattggatgtttcttcgtaggctttattttaa |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
18587610 |
gtgttgatatgatggtggataatcaatataattgaatgtttcttcgtaggttttattttaa |
18587550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University