View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0913_low_82 (Length: 260)

Name: NF0913_low_82
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0913_low_82
NF0913_low_82
[»] chr4 (2 HSPs)
chr4 (32-260)||(34039082-34039310)
chr4 (39-77)||(34039305-34039343)


Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 32 - 260
Target Start/End: Complemental strand, 34039310 - 34039082
Alignment:
32 aaatgatattaagttgatttgcattgtgaaattgtgagcaaaatgagatttttgagtaaccacattgtgccaaatggatttatttttgcacgtatattga 131  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34039310 aaatgatattaagttgatttgcgttgtgaaattgtgagcaaaatgagatttttgagtaaccacattgtgccaaatggatttatttttgcacgtatattga 34039211  T
132 tttatgaatgaatttgtttagttcagnnnnnnngataggaaaatcagttatgaagggtgtttttggggtatgaatttttgttcttaattgtaacttgtaa 231  Q
    ||||||||||||||||||||||||||        |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34039210 tttatgaatgaatttgtttagttcagttttttttatagcaaaatcagttatgaagggtgtttttggggtatgaatttttgttcttaattgtaacttgtaa 34039111  T
232 aatttacattgctaaatgttcatataatt 260  Q
    |||||||||||||||||| ||||||||||    
34039110 aatttacattgctaaatgctcatataatt 34039082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 39 - 77
Target Start/End: Complemental strand, 34039343 - 34039305
Alignment:
39 attaagttgatttgcattgtgaaattgtgagcaaaatga 77  Q
    |||||||||||||||||||||||||||||||| ||||||    
34039343 attaagttgatttgcattgtgaaattgtgagcgaaatga 34039305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University