View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_82 (Length: 260)
Name: NF0913_low_82
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_82 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 32 - 260
Target Start/End: Complemental strand, 34039310 - 34039082
Alignment:
| Q |
32 |
aaatgatattaagttgatttgcattgtgaaattgtgagcaaaatgagatttttgagtaaccacattgtgccaaatggatttatttttgcacgtatattga |
131 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34039310 |
aaatgatattaagttgatttgcgttgtgaaattgtgagcaaaatgagatttttgagtaaccacattgtgccaaatggatttatttttgcacgtatattga |
34039211 |
T |
 |
| Q |
132 |
tttatgaatgaatttgtttagttcagnnnnnnngataggaaaatcagttatgaagggtgtttttggggtatgaatttttgttcttaattgtaacttgtaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34039210 |
tttatgaatgaatttgtttagttcagttttttttatagcaaaatcagttatgaagggtgtttttggggtatgaatttttgttcttaattgtaacttgtaa |
34039111 |
T |
 |
| Q |
232 |
aatttacattgctaaatgttcatataatt |
260 |
Q |
| |
|
|||||||||||||||||| |||||||||| |
|
|
| T |
34039110 |
aatttacattgctaaatgctcatataatt |
34039082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 39 - 77
Target Start/End: Complemental strand, 34039343 - 34039305
Alignment:
| Q |
39 |
attaagttgatttgcattgtgaaattgtgagcaaaatga |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34039343 |
attaagttgatttgcattgtgaaattgtgagcgaaatga |
34039305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University