View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_92 (Length: 229)
Name: NF0913_low_92
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0913_low_92 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 16 - 150
Target Start/End: Original strand, 28168604 - 28168738
Alignment:
| Q |
16 |
atttttaacaaggatgtctttacatggtgtattcaactttcgtttcctagcttcttcaaacttcttaaattcatccatcatgtctcctatcttgtcgaca |
115 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28168604 |
atttctaacaaggatgtccttacatggtgtattcaactttcttttcctagcttcttcaaacttcttaaattcatccatcatgtctcctatcttgtcgaca |
28168703 |
T |
 |
| Q |
116 |
accactcttatcttctcgtgtatatcttcatctca |
150 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
28168704 |
accactcttatcttctcgtgtatatcctcatctca |
28168738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University