View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0913_low_94 (Length: 227)
Name: NF0913_low_94
Description: NF0913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0913_low_94 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 30 - 109
Target Start/End: Complemental strand, 24646795 - 24646716
Alignment:
Q |
30 |
ggtttttaggatgaagccaagtaattggctcatgtttaaagatctttccttctgtaaagataaacctgtctctctctgct |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24646795 |
ggtttttaggatgaagccaagtaattggctcatgtttaaagatctttccttctgtaaagataaacctgtctctctctgct |
24646716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 34 - 106
Target Start/End: Complemental strand, 24637856 - 24637784
Alignment:
Q |
34 |
tttaggatgaagccaagtaattggctcatgtttaaagatctttccttctgtaaagataaacctgtctctctct |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
T |
24637856 |
tttaggatgaagccaagtaattggctcatgtttaaaaatctttccttctgtaaagataaaactgtctctctct |
24637784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 102
Target Start/End: Complemental strand, 24716463 - 24716418
Alignment:
Q |
57 |
gctcatgtttaaagatctttccttctgtaaagataaacctgtctct |
102 |
Q |
|
|
|||||||||||||||| ||||||||| ||||||||||||| ||||| |
|
|
T |
24716463 |
gctcatgtttaaagatttttccttctataaagataaacctatctct |
24716418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 93
Target Start/End: Complemental strand, 24713294 - 24713235
Alignment:
Q |
33 |
ttttaggatgaagccaagtaattggctcatgtttaaagatctttccttctgtaaagataaa |
93 |
Q |
|
|
|||||||||||||| ||||||||| ||||| |||| |||||||||||||| ||| |||||| |
|
|
T |
24713294 |
ttttaggatgaagctaagtaattgcctcat-tttatagatctttccttctataatgataaa |
24713235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 94
Target Start/End: Complemental strand, 24639812 - 24639751
Alignment:
Q |
33 |
ttttaggatgaagccaagtaattggctcatgtttaaagatctttccttctgtaaagataaac |
94 |
Q |
|
|
||||| |||||||| || |||||| |||||||| | |||||||||||||| | ||||||||| |
|
|
T |
24639812 |
ttttacgatgaagctaaataattgtctcatgttcatagatctttccttctatcaagataaac |
24639751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University