View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_high_18 (Length: 432)
Name: NF0914_high_18
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0914_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 413; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 413; E-Value: 0
Query Start/End: Original strand, 1 - 421
Target Start/End: Original strand, 12451883 - 12452303
Alignment:
| Q |
1 |
caagcttgtaaatatcgaccttcctatactatctatgatggaacttatgtgtgtcaacaagttctgatgcagattgttctgcgtaaacatatactttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12451883 |
caagcttgtaaatatcgaccttcctatactatctatgatggaacttatgtgtgtcaacaagttctgatgcagattgttctgcgtaaacatatactttctt |
12451982 |
T |
|
| Q |
101 |
ttattgttcatagcttcattaatatcttttattttttcccttatcaaaattagaagtttagccaacaactcaaaactctttcccttttgcctattttctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12451983 |
ttattgttcatagcttcattaatatcttttattttttcccttatcaaaattagaagtttagccaacaactcaaaactctttcccttttgcctattttctc |
12452082 |
T |
|
| Q |
201 |
tgtagaaatcaccgggagaagagattattgagtttgaggttcctctaaagtttgtggaggtggaccaggaacaagccagacttgtccttagccaccgcaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12452083 |
tgtagaaatcaccgggagaagagattattgagtttgaggttcctctaaagtttgtggaggtggaccaggaacaagctagacttgtccttagccaccgcaa |
12452182 |
T |
|
| Q |
301 |
agccgtagccggcatccaaggacaactaggaattggatcagttgtcaccggcactgtgcaaagcctaaagccatatggtgcctttatcgacattggtggt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12452183 |
agccgtagccggcatccaaggacaactaggaattggatcagttgtcactggcactgtgcaaagcctaaagccatatggtgcctttatcgacattggtggt |
12452282 |
T |
|
| Q |
401 |
ggaatcagtggccttcttcat |
421 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
12452283 |
ggaatcagtggccttcttcat |
12452303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 894 times since January 2019
Visitors: 6705