View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_high_29 (Length: 370)
Name: NF0914_high_29
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0914_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 44767124 - 44766782
Alignment:
| Q |
1 |
ttaatttcccgcgaattccttccgcattttaatatcactctcactctc------------tctactcttgcagcaacgcaacacacacaacaatgtcgcg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44767124 |
ttaatttcccgcgaattccttccgcattttaatatcactctcactctcactctcactctctctactcttgcagcaac-----acacacaacaatgtcgcg |
44767030 |
T |
 |
| Q |
89 |
tcgtaatagcaatggtagatcacccctcgtcaatccacagcgtcaaatcacttctttcttcaccaaatccacttctcccctttcaccttctctctccaaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44767029 |
tcgtaatagcaatggtagatcacccctcgtcaatccacagcgtcaaatcacttctttcttcaccaaatccacttctcccctttcaccttctctctccaaa |
44766930 |
T |
 |
| Q |
189 |
accctaaaatcaaaccccaataaccccatttctaaatctaatcctaaccctagtccttccctaactacaccttcacctctcaatcccaatgaaccacaca |
288 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44766929 |
accctaaaatcaaaccctaataaccccatttctaaatctaatcctaaccctagtcctaccctaactacaccttcacctctcaatcccaataaaccacaca |
44766830 |
T |
 |
| Q |
289 |
aaccccgtctcgtcatcgacgctcctcccacaatatcacctccccctt |
336 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44766829 |
aaccccgtctcgtcatcgacgctcctcctacaatatcacctccccctt |
44766782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University