View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_high_38 (Length: 314)
Name: NF0914_high_38
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0914_high_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 72 - 301
Target Start/End: Complemental strand, 42033699 - 42033470
Alignment:
| Q |
72 |
agattaccttaaaactttctatgaggacactaaactggatacacataaacaggctttggaaaaaattccagaggttcaaccttatatcacttcttcgctt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42033699 |
agattaccttaaaactttctatgaggacactaaactggatacacataaacaggctttggaaaaaattccagaggttcaaccttatatcacttcttcgctt |
42033600 |
T |
|
| Q |
172 |
ttcatccgcagcgttgcatctccaacagctatatttgttcgcattcagacagaaaatgatgaaggagagcggatagacgagatcatcaagaaccatattg |
271 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42033599 |
ttcatccgcagcgttgcatctccaacggctatatttgttcgcattcagacagaaaatgatgaaggagagcggatagacgagatcatcaagaaccatattg |
42033500 |
T |
|
| Q |
272 |
acccggtttcgaagcaagtgttggggatat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42033499 |
acccggtttcgaagcaagtgttggggatat |
42033470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1103 times since January 2019
Visitors: 6709