View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_high_65 (Length: 241)
Name: NF0914_high_65
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0914_high_65 |
 | |
|
| [»] scaffold0608 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 24 - 209
Target Start/End: Complemental strand, 18093682 - 18093496
Alignment:
| Q |
24 |
gccattgcccattctagtgtgtatgttgttgtgtctgttcctgcaacaaatatgttctggtatacatacgaaaattatttagtacaaagtttagattata |
123 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18093682 |
gccattgcccattctagagtgtatgttgttgtgtctgttcctgcaacaaatatgttctggtatacataccaaaattatttagtacaaagtttagattata |
18093583 |
T |
|
| Q |
124 |
gaattttgaattaatatttaatttggtctttaaaacagtaagactgtatccaatttttatactatgccactaa-aaaaggttatatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
18093582 |
gaattttgaattaatatttaatttggtctttaaaattgtaagactatatccaattttcatactatgccactaaaaaaaggttatatt |
18093496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 24 - 107
Target Start/End: Complemental strand, 18103690 - 18103607
Alignment:
| Q |
24 |
gccattgcccattctagtgtgtatgttgttgtgtctgttcctgcaacaaatatgttctggtatacatacgaaaattatttagta |
107 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18103690 |
gccattgcccattctagtgtgtatgttattgtgtctgttcctgcaacaaatatgttctggtatacataccaaaattatttagta |
18103607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 76
Target Start/End: Complemental strand, 8137 - 8085
Alignment:
| Q |
24 |
gccattgcccattctagtgtgtatgttgttgtgtctgttcctgcaacaaatat |
76 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||||||| ||||||||||| |
|
|
| T |
8137 |
gccattgcccattctaatgttgatgttgttgtatctgttccggcaacaaatat |
8085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 11106782 - 11106834
Alignment:
| Q |
24 |
gccattgcccattctagtgtgtatgttgttgtgtctgttcctgcaacaaatat |
76 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||||||| ||||||||||| |
|
|
| T |
11106782 |
gccattgcccattctaatgttgatgttgttgtatctgttccggcaacaaatat |
11106834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 746 times since January 2019
Visitors: 6696