View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0914_low_101 (Length: 212)

Name: NF0914_low_101
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0914_low_101
NF0914_low_101
[»] chr1 (1 HSPs)
chr1 (83-212)||(10117002-10117129)


Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 83 - 212
Target Start/End: Original strand, 10117002 - 10117129
Alignment:
83 ataatatgtagcaatgatggtttggactaatggtgcgttaacatcgacacatgtagttagattcaatcacttcaattannnnnnnnnaactttttacatg 182  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||          |||||||||||||    
10117002 ataatatgtagcaatgatggtttggactaatggtgtgttaacatcgacacatgtagttagattcaatcacttcaatt--ttttttttaactttttacatg 10117099  T
183 tttacttgttgatgtcagcatcgtgtagcg 212  Q
    ||||||||||||||||||||||||||||||    
10117100 tttacttgttgatgtcagcatcgtgtagcg 10117129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University