View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_102 (Length: 212)
Name: NF0914_low_102
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0914_low_102 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 85 - 212
Target Start/End: Original strand, 10117004 - 10117129
Alignment:
Q |
85 |
aatatgtagcaatgatggtttggactaatggtgcgttaacatcgacacatgtagttagattcaatcacttcaattannnnnnnnnaactttttacatgtt |
184 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
10117004 |
aatatgtagcaatgatggtttggactaatggtgtgttaacatcgacacatgtagttagattcaatcacttcaatt--ttttttttaactttttacatgtt |
10117101 |
T |
 |
Q |
185 |
tacttgttgatgtcagcatcgtgtagcg |
212 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
10117102 |
tacttgttgatgtcagcatcgtgtagcg |
10117129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 308 times since January 2019
Visitors: 6702