View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0914_low_30 (Length: 396)

Name: NF0914_low_30
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0914_low_30
NF0914_low_30
[»] chr7 (1 HSPs)
chr7 (114-172)||(4094614-4094669)


Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 114 - 172
Target Start/End: Complemental strand, 4094669 - 4094614
Alignment:
114 ctagttctgttttattatcatcttttgaacgttgtggaaatataatatcaccctcgttc 172  Q
    |||||||||||||||||||   ||||||||||||| |||||||||||| ||||||||||    
4094669 ctagttctgttttattatc---ttttgaacgttgttgaaatataatataaccctcgttc 4094614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University