View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_49 (Length: 322)
Name: NF0914_low_49
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0914_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 41 - 233
Target Start/End: Original strand, 49928507 - 49928703
Alignment:
| Q |
41 |
acttggtaggtttaactggttttactattatgttaaattaaatctgcattatctctatatcatgaattatgatgagttttttatattaattttgttgg-- |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49928507 |
acttggtaggtttaactggttttactattatgttaaattaaatctgcattatctctatatcatgaattatgatgagttttttatattaattttgttggtt |
49928606 |
T |
 |
| Q |
139 |
--nnnnnnnnctgtagccttacaacttcatccagataagaacaaacatccaaaagctgaaattgccttcaaacttgtttctgaggttagttttgtca |
233 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49928607 |
ttttttttttctctagccttacaacttcatccagataagaacaaacatccaaaagctgaaattgccttcaaacttgtttctgaggttagttttgtca |
49928703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 273 - 314
Target Start/End: Original strand, 49928740 - 49928781
Alignment:
| Q |
273 |
caagtattgtaacaatggtacaaaatctcatttccctatgct |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49928740 |
caagtattgtaacaatggtacaaaatctcatttccctctgct |
49928781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 151 - 228
Target Start/End: Complemental strand, 13696126 - 13696049
Alignment:
| Q |
151 |
agccttacaacttcatccagataagaacaaacatccaaaagctgaaattgccttcaaacttgtttctgaggttagttt |
228 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||| || ||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
13696126 |
agccttgcaacttcatccagataagaataaacatcccaaggctgaaattgcattcaagcttgtctctgaggttagttt |
13696049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University