View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0914_low_51 (Length: 314)

Name: NF0914_low_51
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0914_low_51
NF0914_low_51
[»] chr5 (1 HSPs)
chr5 (72-301)||(42033470-42033699)


Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 72 - 301
Target Start/End: Complemental strand, 42033699 - 42033470
Alignment:
72 agattaccttaaaactttctatgaggacactaaactggatacacataaacaggctttggaaaaaattccagaggttcaaccttatatcacttcttcgctt 171  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42033699 agattaccttaaaactttctatgaggacactaaactggatacacataaacaggctttggaaaaaattccagaggttcaaccttatatcacttcttcgctt 42033600  T
172 ttcatccgcagcgttgcatctccaacagctatatttgttcgcattcagacagaaaatgatgaaggagagcggatagacgagatcatcaagaaccatattg 271  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42033599 ttcatccgcagcgttgcatctccaacggctatatttgttcgcattcagacagaaaatgatgaaggagagcggatagacgagatcatcaagaaccatattg 42033500  T
272 acccggtttcgaagcaagtgttggggatat 301  Q
    ||||||||||||||||||||||||||||||    
42033499 acccggtttcgaagcaagtgttggggatat 42033470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 580 times since January 2019
Visitors: 6696