View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_54 (Length: 297)
Name: NF0914_low_54
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0914_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 12451866 - 12451599
Alignment:
Q |
1 |
tattgcatcaacgctttgagatttgcagtcattagagttaggttgtttacaccgtttctctcaatagccattgtagcttttttacttgccaaatgacaag |
100 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12451866 |
tattgcatcaacgctttgagatttgcaatcattagagttaggttgtttacaccgtttctctcaatagccattgtagcttttttacttgccaaatgacaag |
12451767 |
T |
 |
Q |
101 |
ttttgattcaatgcatgtaagttcataaatatcaaagtaggtaaagagctaaccgttgacatctgtgagaatggaacaaatcccttaaggccttcaactt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12451766 |
ttttgattcaatgcatgtaagttcataaatatcaaagtaggtaaagagctaaccgttgacatctgtgagaatggaacaaatcccttaaggccttcaactt |
12451667 |
T |
 |
Q |
201 |
ccgccaccacaccacctttatttgcatcaataatctgccacacaaattttacacatatgagtgaaaaa |
268 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12451666 |
cagccaccacaccacctttatttgcatcaataatctgccacacaaattttacacatatgagtgaaaaa |
12451599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University