View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_55 (Length: 296)
Name: NF0914_low_55
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0914_low_55 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 296
Target Start/End: Complemental strand, 50710259 - 50709955
Alignment:
| Q |
1 |
catcatattctcgtcggcaaaacttcatcgtctcacaaagtgatcgaagcaacaacagtcattttctcaatatacatctcactcaaccgccataaaactc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50710259 |
catcatattctcgtcggcaaaacttcatcgtctcacaaagtgatcgaagcaacaacagtcattttctcaatatacat----ctcaaccgccataaaactc |
50710164 |
T |
|
| Q |
101 |
tatatgaataaaaactcttctcaacacttatgatcaaacataggt-----------atgttcaacgcatgacttggctttctaaatgattct-ctcatgc |
188 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50710163 |
tatatgaataaaaactcttctcaacatttatgatcaaacataggtatcttcaatgaatgttcaacgcatgacttggctttctaaatgattctcctcatgc |
50710064 |
T |
|
| Q |
189 |
aattcaccaaacacaattgtatgttcatttggaagcat-ctctttatatgtacatataaaatcactttgatgtgcccctttggctaaataccctagcata |
287 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
50710063 |
aattcaccaaacacaattgcatgttcatttcgaagcatcctctttatatgtacatataaaatcactttgatgcgcccctttggctcaataccctagcata |
50709964 |
T |
|
| Q |
288 |
aggcttagg |
296 |
Q |
| |
|
||||||||| |
|
|
| T |
50709963 |
aggcttagg |
50709955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5 times since January 2019
Visitors: 6700