View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_57 (Length: 283)
Name: NF0914_low_57
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0914_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 30 - 268
Target Start/End: Complemental strand, 14166471 - 14166233
Alignment:
Q |
30 |
gatgcgctcacccgtgtgattgtgagcagagctcagcatgacctaaaagtcatctcagatgtttactacaaaagaaacagtgttcttcttgagcatgttg |
129 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14166471 |
gatgcgctgacccgtgtgattgtgagcagagctcagcatgacctaaaagtcatctcagatgtttactacaaaagaaacagtgttcttcttgagcatgttg |
14166372 |
T |
 |
Q |
130 |
tggccaaggaaacttcaggggattacaagaagtttcttctcactctcttggggaaagaggaatgagtttttcccttctcttgatggagcttgtgcttaat |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14166371 |
tggccaaggaaacttcaggggattacaagaagtttcttctcactctcttggggaaagaggaatgagtttttcccttctcttgatggagcttgtgcttaat |
14166272 |
T |
 |
Q |
230 |
agtttaatcaagacttaaagttgtgatgttttggtttat |
268 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14166271 |
agtttaatcaagacttaaagttgtgatgttttggtttat |
14166233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 93 - 185
Target Start/End: Original strand, 5181674 - 5181766
Alignment:
Q |
93 |
tactacaaaagaaacagtgttcttcttgagcatgttgtggccaaggaaacttcaggggattacaagaagtttcttctcactctcttggggaaa |
185 |
Q |
|
|
|||||||| ||||||||||||| |||||| ||| || |||||||||| |||||||| ||||||||||| | |||||||| ||||||||| |
|
|
T |
5181674 |
tactacaagagaaacagtgttcatcttgaagatgaagtttccaaggaaacctcaggggactacaagaagttcatcctcactcttttggggaaa |
5181766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 96 - 192
Target Start/End: Original strand, 5246335 - 5246431
Alignment:
Q |
96 |
tacaaaagaaacagtgttcttcttgagcatgttgtggccaaggaaacttcaggggattacaagaagtttcttctcactctcttggggaaagaggaat |
192 |
Q |
|
|
||||| ||||| ||||| | |||||||||| |||||||| |||||||||| ||||||||||| ||||| || ||||| |||||||||| |||| |
|
|
T |
5246335 |
tacaagagaaatagtgtccaacttgagcatgcagtggccaaaaaaacttcaggagattacaagaaatttctccttactctgatggggaaagaagaat |
5246431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 496 times since January 2019
Visitors: 6696