View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_58 (Length: 283)
Name: NF0914_low_58
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0914_low_58 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 50 - 283
Target Start/End: Original strand, 34097813 - 34098046
Alignment:
| Q |
50 |
caagatgcatgttaatataaggagttaaaaagtgtttctttttccatgtagtaagagttgtatggcagagtggctgcctgtggcaaacatgctatatctc |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34097813 |
caagatgcatgttaatataaggagttaaaaagtgtttctttttccatgtagtaagagttgtatggcagagtggctgcctgtggcaaacatgctatatctc |
34097912 |
T |
|
| Q |
150 |
tttgttctacttattatgaccacctttttaccttttaacttttctgtaatctctcttctttaggtaaaactgcaccctaatatctctccctatgttctct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34097913 |
tttgttctacttattatgaccacctttttaccttttaacttttctgtaatctctcttctttaggtaaaactgcaccctaatatctctccctatgttctct |
34098012 |
T |
|
| Q |
250 |
tttcttactcacagttcaaacataggactacatc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34098013 |
tttcttactcacagttcaaacataggactacatc |
34098046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University