View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_64 (Length: 271)
Name: NF0914_low_64
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0914_low_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 32 - 228
Target Start/End: Complemental strand, 38328745 - 38328549
Alignment:
| Q |
32 |
cacagacaacatcccccaagccaccaacctgttacagaaacaactcaatctaaatatcagtaagtaataagaaaaacagattaattgaaagcagaagatc |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38328745 |
cacagacaacatcccccaagccaccaacctgttacagaaacaactcaatctaaatatcagtaagtaataagaaaaacagattaattgaaagcagaagatc |
38328646 |
T |
|
| Q |
132 |
atgcaccatccttggaagaacaatatggaaaggtatggtactagtcatttttaccgcagtgttctagagttttgggaactcgacagtagaatgatga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38328645 |
atgcaccatccttggaagaacaatatggaaaggtatggtactagtcatttttaccgcagtgttctagagttttgggaactcgacagtagaatgatga |
38328549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 597 times since January 2019
Visitors: 6705